Commande rapide

Humain IL17BR / IL17RB / IL-17 Receptor B expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Humain IL17RB Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:NM_018725.3
    Taille du ADNc:1509bp
    Description du ADNc:Full length Clone DNA of Homo sapiens interleukin 17 receptor B with N terminal Myc tag.
    Synonyme du gène:CRL4, EVI27, IL17BR, IL17RH1, MGC5245
    Espèces:Human
    Vecteur:pCMV3-SP-N-Myc
    Plasmid:
    Site de restriction:
    Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with IL17RB qPCR primers for gene expression analysis, HP100209 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Humain IL17BR / IL17RB / IL-17 Receptor B expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur on other vectors
    Humain IL17BR / IL17RB / IL-17 Receptor B expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG13091-ACGCHF290
    Humain IL17BR / IL17RB / IL-17 Receptor B expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG13091-ACRCHF290
    Humain IL17BR / IL17RB / IL-17 Receptor B expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG13091-CFCHF260
    Humain IL17BR / IL17RB / IL-17 Receptor B expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG13091-CHCHF260
    Humain IL17BR / IL17RB / IL-17 Receptor B expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG13091-CMCHF260
    Humain IL17BR / IL17RB / IL-17 Receptor B expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG13091-CYCHF260
    Humain IL17BR / IL17RB / IL-17 Receptor B Gène ADNc clone le vecteur de clonageHG13091-MCHF90
    Humain IL17BR / IL17RB / IL-17 Receptor B expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG13091-M-FCHF260
    Humain IL17BR / IL17RB / IL-17 Receptor B expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG13091-NFCHF260
    Humain IL17BR / IL17RB / IL-17 Receptor B expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG13091-NHCHF260
    Humain IL17BR / IL17RB / IL-17 Receptor B expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG13091-NMCHF260
    Humain IL17BR / IL17RB / IL-17 Receptor B expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG13091-NYCHF260
    Humain IL17BR / IL17RB / IL-17 Receptor B expression plasmide de Gène l'ADNc ORF cloneHG13091-UTCHF260
     En savoir plus sur les vecteurs d'expression
    Product nameProduct name
    Références
  • Rickel EA, et al.. (2008) Identification of functional roles for both IL-17RB and IL-17RA in mediating IL-25-induced activities. J Immunol. 181(6): 4299-310.
  • Stock P, et al.. (2009) Induction of airway hyperreactivity by IL-25 is dependent on a subset of invariant NKT cells expressing IL-17RB. J Immunol. 182(8): 5116-22.
  • Wang H, et al.. (2010) Allergen challenge of peripheral blood mononuclear cells from patients with seasonal allergic rhinitis increases IL-17RB, which regulates basophil apoptosis and degranulation. Clin Exp Allergy. 40(8): 1194-202.
  • Size / Price
    Catalogue : HG13091-NM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »