Commande rapide

Humain IL17BR / IL17RB / IL-17 Receptor B expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human IL17RB Informations sur les produits clonés de cDNA
Taille du ADNc:1509bp
Description du ADNc:Full length Clone DNA of Homo sapiens interleukin 17 receptor B with N terminal Myc tag.
Synonyme du gène:CRL4, EVI27, IL17BR, IL17RH1, MGC5245
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humain IL17BR / IL17RB / IL-17 Receptor B expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur on other vectors
Humain IL17BR / IL17RB / IL-17 Receptor B expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG13091-ACGCHF290
Humain IL17BR / IL17RB / IL-17 Receptor B expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG13091-ACRCHF290
Humain IL17BR / IL17RB / IL-17 Receptor B expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG13091-CFCHF260
Humain IL17BR / IL17RB / IL-17 Receptor B expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG13091-CHCHF260
Humain IL17BR / IL17RB / IL-17 Receptor B expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG13091-CMCHF260
Humain IL17BR / IL17RB / IL-17 Receptor B expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG13091-CYCHF260
Humain IL17BR / IL17RB / IL-17 Receptor B Gène ADNc clone le vecteur de clonageHG13091-MCHF90
Humain IL17BR / IL17RB / IL-17 Receptor B expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG13091-M-FCHF260
Humain IL17BR / IL17RB / IL-17 Receptor B expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG13091-NFCHF260
Humain IL17BR / IL17RB / IL-17 Receptor B expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG13091-NHCHF260
Humain IL17BR / IL17RB / IL-17 Receptor B expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG13091-NMCHF260
Humain IL17BR / IL17RB / IL-17 Receptor B expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG13091-NYCHF260
Humain IL17BR / IL17RB / IL-17 Receptor B expression plasmide de Gène l'ADNc ORF cloneHG13091-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
  • Rickel EA, et al.. (2008) Identification of functional roles for both IL-17RB and IL-17RA in mediating IL-25-induced activities. J Immunol. 181(6): 4299-310.
  • Stock P, et al.. (2009) Induction of airway hyperreactivity by IL-25 is dependent on a subset of invariant NKT cells expressing IL-17RB. J Immunol. 182(8): 5116-22.
  • Wang H, et al.. (2010) Allergen challenge of peripheral blood mononuclear cells from patients with seasonal allergic rhinitis increases IL-17RB, which regulates basophil apoptosis and degranulation. Clin Exp Allergy. 40(8): 1194-202.
  • Size / Price
    Catalogue : HG13091-NM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.