Commande rapide

Text Size:AAA

Humain IL-17RD expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human IL17RD Informations sur les produits clonés de cDNA
Taille du ADNc:2220bp
Description du ADNc:Full length Clone DNA of Homo sapiens interleukin 17 receptor D with N terminal HA tag.
Synonyme du gène:SEF, IL-17RD, IL17RLM, FLJ35755, MGC133309, DKFZp434N1928
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

Interleukin-17 receptor D (IL-17D) also known as Interleukin-17 receptor-like protein, is a member of interleukine-17 recepter family. IL-17RD functions as a feedback inhibitor of fibroblast growth factor mediated Ras-MAPK signaling and ERK activation. It may inhibit FGF-induced FGFR1 tyrosine phosphorylation, regulate the nuclear ERK signaling pathway by spatially blocking nuclear translocation of activated ERK By similarity, and mediate JNK activation and may be involved in apoptosis. IL-17RD is found expressed in the neopallial cortex, rhombic lip and dorsal regions of the myelencephalon and in the frontal nasal process. IL-17RD is also expressed in the commissural plate and septal area of the forebrain and in the hippocampus, lens and optic cup. In the oral region, IL-17RD is expressed in the tongue and in the mesenchyme of the first branchial arch. It is also expressed in the developing inner ear. IL-17RD interacts with both IL-17R-Myc and IL-17RB-Myc. Both the intracellular and extracellular domains of IL-17RD interact with IL-17R. IL-17R forms a heteromeric complex with IL-17RD. Experiment results indicate that IL-17RD is able to affect IL-17R localization, suggesting that these two molecules are colocalized and associate with each other within cells. The fact that IL-17RD Delta ICD is unable to mediate IL-17 signaling but functions as a dominant-negative form indicates that the intracellular domain of IL-17RD is pivotal. In addition, IL-17RD interacts with the IL-17R downstream molecule TRAF6. It has been proposed that the IL-17RD intracellular domain interacts with IL-17R and TRAF6 to deliver the downstream signal.

  • Weaver CT, et al.. (2007) IL-17 family cytokines and the expanding diversity of effector T cell lineages. Annu Rev Immunol. 25: 821-52.
  • Rong Z, et al.. (2009) IL-17RD (Sef or IL-17RLM) interacts with IL-17 receptor and mediates IL-17 signaling. Cell Res. 19(2): 208-15.
  • Gaffen SL. (2009) Structure and signalling in the IL-17 receptor family. Nat Rev Immunol. 9(8): 556-67.
  • Size / Price
    Catalogue : HG10507-NY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.