After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain IL-1R2/CD121b transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human IL1R2 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_004633.3
Taille du ADNc:1197bp
Description du ADNc:Full length Clone DNA of Homo sapiens interleukin 1 receptor, type I I, transcript variant 1 with N terminal His tag.
Synonyme du gène:IL1R2, IL1RB, CD121b, MGC47725
Espèces:Human
Vecteur:pCMV3-SP-N-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humain IL-1R2/CD121b transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
Humain IL-1R2/CD121b transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10111-ACGCHF270
Humain IL-1R2/CD121b transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10111-ACRCHF270
Humain IL-1R2/CD121b transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10111-CFCHF230
Humain IL-1R2/CD121b transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10111-CHCHF230
Humain IL-1R2/CD121b transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10111-CMCHF230
Humain IL-1R2/CD121b transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10111-CYCHF230
Humain IL-1R2/CD121b transcript variant 1 Gène ADNc clone le vecteur de clonageHG10111-MCHF90
Humain IL-1R2/CD121b transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10111-M-FCHF230
Humain IL-1R2/CD121b transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10111-NFCHF230
Humain IL-1R2/CD121b transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10111-NHCHF230
Humain IL-1R2/CD121b transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10111-NMCHF230
Humain IL-1R2/CD121b transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10111-NYCHF230
Humain IL-1R2/CD121b transcript variant 1 expression plasmide de Gène l'ADNc ORF cloneHG10111-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

Interleukin 1 receptor, type II (IL1R2) also known as CD121b (Cluster of Differentiation 121b) is a cytokine receptor that belongs to the interleukin-1 receptor family. This protein binds interleukin alpha (IL1A), interleukin beta (IL1B), and interleukin 1 receptor, type I (IL1R1/IL1RA), and acts as a decoy receptor that inhibits the activity of its ligands. The pleiotropic cytokine IL1 is produced to regulate development and maintenance of the inflammatory responses, and binds to specific plasma membrane receptors on cells. Two distinct types of IL1 receptors which are able to bind IL1 specifically have been identified, designated as IL1RI (IL1RA) and IL1RII (IL1RB). IL1R1 contributes to IL-1 signaling, whereas the IL-1R2/CD121b has no signaling property and acts as a decoy for IL-1. IL-1R2/CD121b structurally consisting of a ligand binding portion comprised of three Ig-like domains, a single transmembrane region, and a short cytoplasmic domain, is expressed in a variety of cell types including B lymphocytes, neutrophils, monocytes, large granular leukocytes and endothelial cells. Interleukin 4 (IL4) is reported to antagonize the activity of interleukin 1 by inducing the expression and release of this cytokine.

Références
  • Cannon JG, et al. (1997) Interleukin-1 beta, interleukin-1 receptor antagonist, and soluble interleukin-1 receptor type II secretion in chronic fatigue syndrome. J Clin Immunol. 17 (3): 253-61.
  • Liu C, et al. (1996) Cloning and characterization of an alternatively processed human type II interleukin-1 receptor mRNA. J Biol Chem. 271 (34): 20965-72.
  • Van der Poll T, et al. (1997) Antiinflammatory cytokine responses during clinical sepsis and experimental endotoxemia: sequential measurements of plasma soluble interleukin (IL)-1 receptor type II, IL-10, and IL-13. J Infect Dis. 175 (1): 118-22.
  • Size / Price
    Catalogue : HG10111-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »