Commande rapide

Humain IL21/IL-21 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human IL21 Informations sur les produits clonés de cDNA
Taille du ADNc:405bp
Description du ADNc:Full length Clone DNA of Homo sapiens interleukin 21 with C terminal Myc tag.
Synonyme du gène:Za11, IL-21
Site de restriction:KpnI + XbaI (6kb + 0.45kb)
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human IL21 Gene Plasmid Map
Human IL21 ORF mammalian expression plasmid (Codon Optimized), C-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

IL21 belongs to the IL-15/IL-21 family. It is a cytokine with immunoregulatory activity. Cytokines are proteinaceous signaling compounds that are major mediators of the immune response. They control many different cellular functions including proliferation, differentiation and cell survival/apoptosis but are also involved in several pathophysiological processes including viral infections and autoimmune diseases. Cytokines are synthesized under various stimuli by a variety of cells of both the innate (monocytes, macrophages, dendritic cells) and adaptive (T- and B-cells) immune systems. IL21 is expressed in activated CD4-positive T-cells but not in CD8-positive T-cells, B-cells, or monocytes. It may promote the transition between innate and adaptive immunity. IL-21 has been tried as therapy for alleviating allergic responses. It can significantly decrease pro-inflammatory cytokines produced by T cells in addition to decreasing IgE levels in a mouse model for rhinitis (nasal passage inflammation)

  • Coquet JM, et al. (2007) IL-21 is produced by NKT cells and modulates NKT cell activation and cytokine production. J Immunol. 178(5):2827-34.
  • Wei L, et al. (2007) IL-21 is produced by Th17 cells and drives IL-17 production in a STAT3-dependent manner. J Biol Chem. 282(48):34605-10.
  • Parrish-Novak J, et al. (2002) Interleukin-21 and the IL-21 receptor: novel effectors of NK and T cell responses. J Leukoc Biol. 72(5):856-63. 4 Kuchen S, et al. (2007) Essential role of IL-21 in B cell activation, expansion, and plasma cell generation during CD4+ T cell-B cell collaboration. J Immunol. 179(9):5886-96.
  • Size / Price
    Catalogue : HG10584-CM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    DisponibilitéIn Stock
    Bulk Discount RequiryAjouter au panier
    Contact Us
    • Human IL21 ORF mammalian expression plasmid (Codon Optimized), C-Myc tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.