After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain IL-1F6 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human IL36A Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_014440.1
Taille du ADNc:477bp
Description du ADNc:Full length Clone DNA of Homo sapiens interleukin 1 family, member 6 (epsilon) with C terminal Myc tag.
Synonyme du gène:FIL1, FIL1E, IL-1F6, MGC129552, MGC129553, IL1(EPSILON), FIL1(EPSILON)
Espèces:Human
Vecteur:pCMV3-C-Myc
Plasmid:
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Fond

Interleukin-1 family member 6 (IL-1F6), also known as interleukin 36, alpha (IL36A), is a pro-inflammatory cytokine which plays an important role in innate and adaptive immunity. IL-1F6 activates MAPK and NF-kB pathways and is produced by many different cells. This cytokine is a family member of interleukin-1 (IL-1) and plays an important role in the pathophysiology of several diseases. It has been reported that IL-1F6 and IL-1F8, in addition to IL-1F9, activate the pathway leading to NF-kappaB in an IL-1Rrp2-dependent manner in Jurkat cells as well as in multiple other human and mouse cell lines. Activation of the pathway leading to NF-kappaB by IL-1F6 and IL-1F8 follows a similar time course to activation by IL-1beta, suggesting that signaling by the novel family members occurs through a direct mechanism. In a mammary epithelial cell line, NCI/ADR-RES, which naturally expresses IL-1Rrp2, all three cytokines signal without further receptor transfection. IL-1Rrp2 antibodies block activation of the pathway leading to NF-kappaB by IL-1F6, IL-1F8, and IL-1F9 in both Jurkat and NCI/ADR-RES cells. Thus IL-1F6, IL-1F8, and IL-1F9 signal through IL-1Rrp2 and IL-1RAcP.

Références
  • Tripodi D, et al. (2012) IL-36 a new member of the IL-1 family cytokines. J Biol Regul Homeost Agents. 26(1):7-14.
  • Towne JE, et al. (2004) Interleukin (IL)-1F6, IL-1F8, and IL-1F9 signal through IL-1Rrp2 and IL-1RAcP to activate the pathway leading to NF-kappaB and MAPKs. J Biol Chem. 279(14): 13677-88.
  • Kumar S, et al. (2000) Identification and initial characterization of four novel members of the interleukin-1 family. J Biol Chem. 275(14): 10308-14.
  • Size / Price
    Catalogue : HG10607-CM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »