Commande rapide

Humain IL36B/IL1F8 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human IL36B Informations sur les produits clonés de cDNA
Taille du ADNc:474bp
Description du ADNc:Full length Clone DNA of Homo sapiens interleukin 1 family, member 8 (eta), transcript variant 2 with C terminal Myc tag.
Synonyme du gène:FIL1, FIL1H, IL1H2, IL-1F8, IL-1H2, IL1-ETA, MGC126880, MGC126882, FIL1-(ETA)
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humain IL36B/IL1F8 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur on other vectors
Humain IL36B/IL1F8 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10579-ACGCHF270
Humain IL36B/IL1F8 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10579-ACRCHF270
Humain IL36B/IL1F8 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10579-CFCHF230
Humain IL36B/IL1F8 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10579-CHCHF230
Humain IL36B/IL1F8 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10579-CMCHF230
Humain IL36B/IL1F8 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10579-CYCHF230
Humain IL36B/IL1F8 transcript variant 2 Gène ADNc clone le vecteur de clonageHG10579-MCHF90
Humain IL36B/IL1F8 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10579-M-FCHF230
Humain IL36B/IL1F8 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10579-NFCHF230
Humain IL36B/IL1F8 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10579-NHCHF230
Humain IL36B/IL1F8 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10579-NMCHF230
Humain IL36B/IL1F8 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10579-NYCHF230
Humain IL36B/IL1F8 transcript variant 2 expression plasmide de Gène l'ADNc ORF cloneHG10579-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Interleukin-1 family member 8(IL1F8) also known as IL36B, is a member of the interleukin 1(IL-1) cytokine family. IL1F8 may contains a 12-stranded beta-trefoil structure. Until recently, the IL-1 family of cytokines includ four members, with three having pro-inflammatory effects such as IL1F8 and the fourth member being an IL-1 receptor antagonist (IL-1Ra). IL-1 family members exert their effects through binding to receptors that belong to the IL-1 receptor (IL-1R) family. IL1F8 exerts proinflammatory effects in primary human joint cells. Joint and serum IL-1F8 protein levels did not correlate with inflammation, but they were high in some human serum samples tested, including samples from patients with rheumatoid arthritis. IL1F8 also activated NK-κB.

  • Magne D, et al. (2006) The new IL-1 family member IL-1F8 stimulates production of inflammatory mediators by synovial fibroblasts and articular chondrocytes. Arthritis Research & Therapy. 8: R80.
  • Smith DE, et al. (2000) The new IL-1 family member IL-1F8 stimulates production of inflammatory mediators by synovial fibroblasts and articular chondrocytes. The Journal of Biological Chemistry. 275: 1169-75.
  • Size / Price
    Catalogue : HG10579-CM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.