After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain IL6ST/gp130/CD130 expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human IL6ST Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_002184.3
Taille du ADNc:2757bp
Description du ADNc:Full length Clone DNA of Homo sapiens interleukin 6 signal transducer (gp130, oncostatin M receptor) with C terminal Flag tag.
Synonyme du gène:CD130, GP130, CDW130, IL-6RB
Espèces:Human
Vecteur:pCMV3-C-FLAG
Plasmid:pCMV3-IL6ST-Flag
Site de restriction:HindIII + NotI (6kb + 2.8kb)
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human IL6ST Gene Plasmid Map
Human IL6ST natural ORF mammalian expression plasmid, C-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Fond

Glycoprotein 130 (also known as gp130, IL6ST, IL6-beta or CD130) is a transmembrane protein which is the founding member of the class of all cytokine receptors. CD130/gp130 is a signal transducer shared by many cytokines, including interleukin 6 (IL6), ciliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), and Oncostatin M (OSM). CD130/gp130 functions as a part of the cytokine receptor complex. The activation of this protein is dependent upon the binding of cytokines to their receptors. CD130/gp130 plays a critical role in regulating myocyte apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been described. A related pseudogene has been identified on chromosome 17. The receptor systems for IL6, LIF, OSM, CNTF, IL11, CTF1 and BSF3 can utilize gp130 for initiating signal transmission. CD130/gp130 binds to IL6/IL6R (alpha chain) complex, resulting in the formation of high-affinity IL6 binding sites, and transduces the signal. CD130/gp130 may have a role in embryonic development. The type I OSM receptor is capable of transducing OSM-specific signaling events.

Références
  • Hibi, et al. (1990) Molecular cloning and expression of an IL-6 signal transducer, gp130. Cell. 63 (6): 1149-57.
  • Kim H, et al. (1997) Transmembrane domain of gp130 contributes to intracellular signal transduction in hepatic cells. J Biol Chem. 272 (49): 30741-7.
  • Giordano V, et al. (1997) Shc mediates IL-6 signaling by interacting with gp130 and Jak2 kinase. J Immunol. 158 (9): 4097-103.
  • Size / Price
    Catalogue : HG10974-CF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    DisponibilitéIn Stock
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
    • Human CTSC / DPPI ORF mammalian expression plasmid, C-Flag tag
    • Human IL6ST natural ORF mammalian expression plasmid, C-Flag tag
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »