INF2/C14orf51 cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

INF2/C14orf51 cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
705 bp
Description
Full length Clone DNA of Human inverted formin, FH2 and WH2 domain containing with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

INF2/C14orf51 cDNA ORF Clone, Human, N-Myc tag: Alternative Names

C14orf151 cDNA ORF Clone, Human; C14orf173 cDNA ORF Clone, Human; CMTDIE cDNA ORF Clone, Human; FSGS5 cDNA ORF Clone, Human; pp9484 cDNA ORF Clone, Human
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait