Commande rapide

Text Size:AAA

Humain ING4 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human ING4 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC007781
Taille du ADNc:750bp
Description du ADNc:Full length Clone DNA of Homo sapiens inhibitor of growth family, member 4 with N terminal His tag.
Synonyme du gène:My036, MGC12557, my036, p29ING4, ING4
Espèces:Human
Vecteur:pCMV3-N-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Fond

ING4 is similar to ING1, a tumor suppressor protein that can interact with TP53, inhibit cell growth, and induce apoptosis. ING4 contains a PHD-finger, which is a common motif in proteins involved in chromatin remodeling. ING4 protein can bind TP53 and EP300/p300, a component of the histone acetyl transferase complex, suggesting its involvement in the TP53-dependent regulatory pathway. ING4 is a component of the HBO1 complex which has a histone H4-specific acetyltransferase activity, a reduced activity toward histone H3 and is responsible for the bulk of histone H4 acetylation in vivo. Through chromatin acetylation it may function in DNA replication. ING4 may also inhibit tumor progression by modulating the transcriptional output of signaling pathways which regulate cell proliferation.

Références
  • Shiseki M. et al., 2003, Cancer Res. 63 (10): 2373-8.
  • Garkavtsev. et al., 2004, Nature. 428 (6980): 328-32.
  • Tsai. et al., 2008, Exp Cell Res. 314 (17): 3130-41.
  • Size / Price
    Catalogue : HG14264-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »