Commande rapide

Humain Inhibin beta B/INHBB expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human INHBB Informations sur les produits clonés de cDNA
Taille du ADNc:1224bp
Description du ADNc:Full length Clone DNA of Homo sapiens inhibin, beta B with N terminal Myc tag.
Synonyme du gène:MGC157939, INHBB
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

Activin and inhibin are two closely related protein complexes that have almost directly opposite biological effects. The activin and inhibin protein complexes are both dimeric in structure, and, in each complex, the two monomers are linked to one another by a single disulfide bond. Activin is composed of two ß subunits, ßA ßA (activin A), ßB ßB (activin B), or ßA ßB (activin AB). Inhibin is composed of an alpha and one of two ß subunits, ßA (inhibin A) or ßB (inhibin B). Activins are produced in many cell types and organs, such as gonads, pituitary gland, and placenta. In the ovarian follicle, activin increases FSH binding and FSH-induced aromatization. It participates in androgen synthesis enhancing LH action in the ovary and testis. In the male, activin enhances spermatogenesis. In addition, Activin plays a role in wound repair and skin morphogenesis. Activin is strongly expressed in wounded skin, and overexpression of activin in epidermis of transgenic mice improves wound healing and enhances scar formation. Activin also regulates the morphogenesis of branching organs such as the prostate, lung, and kidney. There is also evidence showed that lack of activin during development results in neural developmental defects.

  • Feng ZM, et al. (1989) Characterization and regulation of testicular inhibin beta-subunit mRNA. Mol Endocrinol. 3 (6): 939-48.
  • Bernard DJ, et al. (2002) Inhibin binding protein (InhBP/p120), betaglycan, and the continuing search for the inhibin receptor. Mol Endocrinol. 16 (2): 207-12.
  • Lejeune H, et al. (1997) Stimulating effect of both human recombinant inhibin A and activin A on immature porcine Leydig cell functions in vitro. Endocrinology. 138 (11): 4783-91.
  • Size / Price
    Catalogue : HG10814-NM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.