After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain LFA-1/CD11a/ITGAL/Integrin alpha L expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human ITGAL Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_002209.2
Taille du ADNc:3513bp
Description du ADNc:Full length Clone DNA of Homo sapiens integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide) with N terminal Myc tag.
Synonyme du gène:CD11A, LFA-1, LFA1A, ITGAL
Espèces:Human
Vecteur:pCMV3-SP-N-Myc
Plasmid:
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humain LFA-1/CD11a/ITGAL/Integrin alpha L expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur on other vectors
Humain LFA-1/CD11a/ITGAL/Integrin alpha L expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10812-ACGCHF450
Humain LFA-1/CD11a/ITGAL/Integrin alpha L expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10812-ACRCHF450
Humain LFA-1/CD11a/ITGAL/Integrin alpha L expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10812-CFCHF410
Humain LFA-1/CD11a/ITGAL/Integrin alpha L expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10812-CHCHF410
Humain LFA-1/CD11a/ITGAL/Integrin alpha L expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10812-CMCHF410
Humain LFA-1/CD11a/ITGAL/Integrin alpha L expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10812-CYCHF410
Humain LFA-1/CD11a/ITGAL/Integrin alpha L Gène ADNc clone le vecteur de clonageHG10812-MCHF90
Humain LFA-1/CD11a/ITGAL/Integrin alpha L expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10812-M-FCHF410
Humain LFA-1/CD11a/ITGAL/Integrin alpha L expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10812-NFCHF410
Humain LFA-1/CD11a/ITGAL/Integrin alpha L expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10812-NHCHF410
Humain LFA-1/CD11a/ITGAL/Integrin alpha L expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10812-NMCHF410
Humain LFA-1/CD11a/ITGAL/Integrin alpha L expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10812-NYCHF410
Humain LFA-1/CD11a/ITGAL/Integrin alpha L expression plasmide de Gène l'ADNc ORF cloneHG10812-UTCHF410
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG10812-NM
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »