Commande rapide

Humain Junctional Adhesion Molecule B expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human JAM2 Informations sur les produits clonés de cDNA
Taille du ADNc:897bp
Description du ADNc:Full length Clone DNA of Homo sapiens junctional adhesion molecule 2 with C terminal Myc tag.
Synonyme du gène:JAMB, CD322, JAM-B, VEJAM, PRO245, VE-JAM, C21orf43
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humain Junctional Adhesion Molecule B expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur on other vectors
Humain Junctional Adhesion Molecule B expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10580-ACGCHF270
Humain Junctional Adhesion Molecule B expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10580-ACRCHF270
Humain Junctional Adhesion Molecule B expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10580-CFCHF230
Humain Junctional Adhesion Molecule B expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10580-CHCHF230
Humain Junctional Adhesion Molecule B expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10580-CMCHF230
Humain Junctional Adhesion Molecule B expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10580-CYCHF230
Humain Junctional Adhesion Molecule B Gène ADNc clone le vecteur de clonageHG10580-MCHF90
Humain Junctional Adhesion Molecule B expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10580-M-FCHF230
Humain Junctional Adhesion Molecule B expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10580-NFCHF230
Humain Junctional Adhesion Molecule B expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10580-NHCHF230
Humain Junctional Adhesion Molecule B expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10580-NMCHF230
Humain Junctional Adhesion Molecule B expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10580-NYCHF230
Humain Junctional Adhesion Molecule B expression plasmide de Gène l'ADNc ORF cloneHG10580-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Junctional adhesion molecule B (JAM-B), also known as Junctional adhesion molecule 2 (JAM2), Vascular endothelial junction-associated molecule (VE-JAM), and CD322, is a single-pass type I membrane protein which belongs to the immunoglobulin superfamily. It is prominently expressed on high endothelial venules. expression to be restricted to the high endothelial venule of tonsil and lymph nodes. The localization to the endothelium of arterioles in and around inflammatory and tumor foci. JAM-B can function as an adhesive ligand for the T cell line J45 and can interact with GM-CSF/IL-4-derived peripheral blood dendritic cells, circulating CD56(+) NK cells, circulating CD56(+)CD3(+) NK/T cells, and circulating CD56(+)CD3(+)CD8(+) cytolytic T cells. JAM-2 is expressed on high endothelial venules (HEVs) in human tonsil and on a subset of human leukocytes, suggesting that JAM-2 plays a central role in the regulation of transendothelial migration. It binds to very late activation antigen (VLA)-4, a leucocyte integrin that contributes to rolling and firm adhesion of lymphocytes to endothelial cells through binding to vascular cell adhesion molecule (VCAM)-1. JAM-B appears to contribute to leucocyte extravasation by facilitating not only transmigration but also rolling and adhesion. JAM-B acts as an adhesive ligand for interacting with a variety of immune cell types and may play a role in lymphocyte homing to secondary lymphoid organs.

  • Johnson-Lger CA, et al. (2002) Junctional adhesion molecule-2 (JAM-2) promotes lymphocyte transendothelial migration. Blood. 2100(7): 2479-86.
  • Liang TW, et al. (2002) Vascular endothelial-junctional adhesion molecule (VE-JAM)/JAM 2 interacts with T, NK, and dendritic cells through JAM 3. J Immunol. 168(4): 1618-26.
  • Ludwig RJ, et al. (2009) Junctional adhesion molecule (JAM)-B supports lymphocyte rolling and adhesion through interaction with alpha4beta1 integrin. Immunology. 128(2): 196-205.
  • Size / Price
    Catalogue : HG10580-CM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.