Commande rapide

Humain JNK2/MAPK9 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

  • Human PKM2 Gene Plasmid Map 5788
Fiche techniqueCommentairesProduits apparentésProtocoles
Humain MAPK9 Informations sur les produits clonés de cDNA
Taille du ADNc:1320 bp
Description du ADNc:Full length Clone DNA of Homo sapiens mitogen-activated protein kinase 9 with N terminal His tag.
Synonyme du gène:JNK2, SAPK, p54a, JNK2A, JNK2B, PRKM9, JNK-55, JNK2BETA, p54aSAPK, JNK2ALPHA, MAPK9
Site de restriction:KpnI + NotI(6kb+1.32kb)
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
( We provide with MAPK9 qPCR primers for gene expression analysis, HP100678 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humain JNK2/MAPK9 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
Humain JNK2/MAPK9 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10745-ACGCHF270
Humain JNK2/MAPK9 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10745-ACRCHF270
Humain JNK2/MAPK9 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10745-ANGCHF270
Humain JNK2/MAPK9 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10745-ANRCHF270
Humain JNK2/MAPK9 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10745-CFCHF230
Humain JNK2/MAPK9 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10745-CHCHF230
Humain JNK2/MAPK9 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10745-CMCHF230
Humain JNK2/MAPK9 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10745-CYCHF230
Humain JNK2/MAPK9 Gène ADNc clone le vecteur de clonageHG10745-MCHF90
Humain JNK2/MAPK9 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10745-M-FCHF230
Humain JNK2/MAPK9 expression plasmide de Gène l'ADNc ORF cloneHG10745-M-NCHF230
Humain JNK2/MAPK9 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10745-NFCHF230
Humain JNK2/MAPK9 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10745-NHCHF230
Humain JNK2/MAPK9 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10745-NMCHF230
Humain JNK2/MAPK9 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10745-NYCHF230
Humain JNK2/MAPK9 expression plasmide de Gène l'ADNc ORF cloneHG10745-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Mitogen-activated protein kinase 9 (MAPK9), also well known as c-Jun N-terminal kinase (JNK2), is a member of MAP kinase subfamily belonging to the protein kinase superfamily. MAPK9 responds to activation by environmental stress and pro-inflammatory cytokines by phosphorylating a number of transcription factors, such as c-Jun and ATF2. The crystal structure of human JNK2 complexed with an indazole inhibitor by applying a high-throughput protein engineering and surface-site mutagenesis approach. A novel conformation of the activation loop is observed, which is not compatible with its phosphorylation by upstream kinases. This activation inhibitory conformation of JNK2 is stabilized by the MAP kinase insert that interacts with the activation loop in an induced-fit manner. It suggest that the MAP kinase insert of JNK2 plays a role in the regulation of JNK2 activation, possibly by interacting with intracellular binding partners. JNK2 deficiency leads to reduced c-Jun degradation, thereby augmenting c-Jun levels and cellular proliferation, and suggests that JNK2 is a negative regulator of cellular proliferation in multiple cell types. JNK2 prevents replicative stress by coordinating cell cycle progression and DNA damage repair mechanisms. JNK2 blocks the ubiquitination of tumor suppressor p53, and thus increases the stability of p53 in nonstressed cells. JNK2 negatively regulates antigen-specific CD8+ T cell expansion and effector function, and thus selectively blocking JNK2 in CD8+ T cells may potentially enhance anti-tumor immune response. Lack of JNK2 expression was associated with higher tumor aneuploidy and reduced DNA damage response. Additionally,the JNK2 protein could be a novel therapeutic target in dry eye disease, and may provide a novel target for prevention of vascular disease and atherosclerosis.

  • Sabapathy K, et al. (2004) JNK2: a negative regulator of cellular proliferation. Cell Cycle. 3(12): 1520-3.
  • Tao J, et al. (2007) JNK2 negatively regulates CD8+ T cell effector function and anti-tumor immune response. Eur J Immunol. 37(3): 818-29.
  • Shaw D, et al. (2008) The crystal structure of JNK2 reveals conformational flexibility in the MAP kinase insert and indicates its involvement in the regulation of catalytic activity. J Mol Biol. 383(4): 885-93.
  • Osto E, et al. (2008) c-Jun N-terminal kinase 2 deficiency protects against hypercholesterolemia-induced endothelial dysfunction and oxidative stress. 118(20): 2073-80.
  • De Paiva CS, et al. (2009) Essential role for c-Jun N-terminal kinase 2 in corneal epithelial response to desiccating stress. Arch Ophthalmol. 127(12): 1625-31.
  • Chen P, et al. (2010) Jnk2 effects on tumor development, genetic instability and replicative stress in an oncogene-driven mouse mammary tumor model. PLoS One. 5(5): e10443.
  • Size / Price
    Catalogue : HG10745-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.