Commande rapide

Text Size:AAA

Humain NKp80 / KLRF1 expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human KLRF1 Informations sur les produits clonés de cDNA
Taille du ADNc:696bp
Description du ADNc:Full length Clone DNA of Homo sapiens Killer ell lectin-like receptor subfamily F, member 1 with C terminal Flag tag.
Synonyme du gène:CLEC5C, MGC119907, MGC119908, MGC119909
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

NKp80, also known as KLRF1, is an activating homodimeric C-type lectin-like receptor which is expressed on nearly all natural killer cells and stimulates their cytoxicity and cytokine release. NKp80 stimulates cytotoxicity upon engagement of its genetically linked ligand: myeloid-specific CTLR activation-induced C-type lectin (AICL). NKp80, but not NKp80 mutated at tyrosine 7 (NKp80/Y7F), is tyrosine phosphorylated. Accordingly, NKp80/Y7F, but not NKp80/Y30F or NKp80/Y37F, failed to induce cytotoxicity. NKp80 phosphopeptides comprising the hemi-ITAM-like sequence surrounding tyrosine 7 bound Lck- and Syk-family kinases; accordingly, cross-linking of NKp80, but not NKp80/Y7F, induced Syk phosphorylation. Moreover, inhibition of Syk kinase, but not ZAP-70 kinase, impaired cytotoxic responses through NKp80. Atypical residues in the hemi-ITAM-like motif of NKp80 cause an altered stoichiometry of phosphorylation but did not substantially affect NK cytotoxicity. Altogether, these results show that NKp80 uses an atypical hemi-ITAM and Syk kinase to trigger cellular cytotoxicity.

  • Kuttruff S. et al., 2009, Blood. 113 (2): 358-69.
  • Dennehy KM. et al., 2011, J Immunol. 186 (2): 657-61.
  • Roda-Navarro P. et al., 2000, Eur J Immunol. 30 (2): 568-76.
  • Size / Price
    Catalogue : HG10984-CF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.