Cytokeratin 19 cDNA ORF Clone, Human, untagged

Cat: HG13154-UT

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Cytokeratin 19 Reagents

CRO Services

Product recommended


All Cytokeratin 19 Reagents

Cytokeratin 19 cDNA ORF Clone, Human, untagged General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1203 bp
Description
Full length Clone DNA of Human keratin 19.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cytokeratin 19 cDNA ORF Clone, Human, untagged Alternative Names

CK19 cDNA ORF Clone, Human;K19 cDNA ORF Clone, Human;K1CS cDNA ORF Clone, Human

Cytokeratin 19 Background Information

Cytokeratin 19 (KRT19) is a cytoplasmic intermediate filament protein, which is responsible for structural rigidity and multipurpose scaffolds. In several cancers, KRT19 is overexpressed and may play a crucial role in tumorigenic transformation.The KRT19 gene encodes cytokeratin 19, an element of the cytoskeleton whose expression is frequently altered in renal cell carcinoma (RCC).KRT19 was identified as one of the key biomarkers for distinguishing cholangiocarcinoma (CCA) and hepatocellular carcinoma.Expression of KRT19 was specifically high in breast cancers and significantly correlated with their invasiveness. Moreover, knockdown of KRT19 led to increased proliferation, migration, invasion, drug resistance, and sphere formation in breast cancer cells via an upregulated NOTCH signaling pathway.
Full Name
keratin 19, type I

Cytokeratin 19 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Cytokeratin 19 cDNA ORF Clone in Cloning Vector, Rat RG80785-U
Cytokeratin 19 cDNA ORF Clone, Rat, untagged RG80785-UT
Cytokeratin 19 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80785-ACG
Cytokeratin 19 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80785-ACGLN
Cytokeratin 19 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80785-ANG
Cytokeratin 19 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80785-ACR
Cytokeratin 19 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80785-ANR
Cytokeratin 19 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80785-CF
Cytokeratin 19 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80785-NF
Cytokeratin 19 cDNA ORF Clone, Rat, C-His tag RG80785-CH
Cytokeratin 19 cDNA ORF Clone, Rat, N-His tag RG80785-NH
Cytokeratin 19 cDNA ORF Clone, Rat, C-HA tag RG80785-CY
Cytokeratin 19 cDNA ORF Clone, Rat, N-HA tag RG80785-NY
Cytokeratin 19 cDNA ORF Clone, Rat, C-Myc tag RG80785-CM
Cytokeratin 19 cDNA ORF Clone, Rat, N-Myc tag RG80785-NM
Cytokeratin 19 qPCR Primer Pairs, Rat RP300749

Cytokeratin 19 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Cytokeratin 19 cDNA ORF Clone in Cloning Vector, Mouse MG53230-G
Cytokeratin 19 cDNA ORF Clone, Mouse, untagged MG53230-UT
Cytokeratin 19 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53230-ACG
Cytokeratin 19 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53230-ACGLN
Cytokeratin 19 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53230-ANG
Cytokeratin 19 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53230-ACR
Cytokeratin 19 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53230-ANR
Cytokeratin 19 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53230-CF
Cytokeratin 19 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53230-NF
Cytokeratin 19 cDNA ORF Clone, Mouse, C-His tag MG53230-CH
Cytokeratin 19 cDNA ORF Clone, Mouse, N-His tag MG53230-NH
Cytokeratin 19 cDNA ORF Clone, Mouse, C-HA tag MG53230-CY
Cytokeratin 19 cDNA ORF Clone, Mouse, N-HA tag MG53230-NY
Cytokeratin 19 cDNA ORF Clone, Mouse, C-Myc tag MG53230-CM
Cytokeratin 19 cDNA ORF Clone, Mouse, N-Myc tag MG53230-NM

Cytokeratin 19 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Cytokeratin 19 cDNA ORF Clone in Cloning Vector, Human HG13154-G
Cytokeratin 19 cDNA ORF Clone, Human, C-GFPSpark® tag HG13154-ACG
Cytokeratin 19 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13154-ACGLN
Cytokeratin 19 cDNA ORF Clone, Human, N-GFPSpark® tag HG13154-ANG
Cytokeratin 19 cDNA ORF Clone, Human, C-OFPSpark® tag HG13154-ACR
Cytokeratin 19 cDNA ORF Clone, Human, N-OFPSpark® tag HG13154-ANR
Cytokeratin 19 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13154-CF
Cytokeratin 19 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13154-NF
Cytokeratin 19 cDNA ORF Clone, Human, C-His tag HG13154-CH
Cytokeratin 19 cDNA ORF Clone, Human, N-His tag HG13154-NH
Cytokeratin 19 cDNA ORF Clone, Human, C-HA tag HG13154-CY
Cytokeratin 19 cDNA ORF Clone, Human, N-HA tag HG13154-NY
Cytokeratin 19 cDNA ORF Clone, Human, C-Myc tag HG13154-CM
Cytokeratin 19 cDNA ORF Clone, Human, N-Myc tag HG13154-NM
Cytokeratin 19 qPCR Primer Pairs, Human HP101710
info info
添加购物车成功! 添加购物车失败!