Commande rapide

Humain L3MBTL4 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Humain L3MBTL4 Informations sur les produits clonés de cDNA
Taille du ADNc:1605bp
Description du ADNc:Full length Clone DNA of Homo sapiens l(3)mbt-like 4 (Drosophila) with N terminal His tag.
Synonyme du gène:HsT1031
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
( We provide with L3MBTL4 qPCR primers for gene expression analysis, HP103478 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Size / Price
Catalogue : HG14847-NH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Ajouter au panierBulk Discount Requiry
Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.