Commande rapide

Text Size:AAA

Humain Lipopolysaccharide binding Protéine/LBP expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human LBP Informations sur les produits clonés de cDNA
Taille du ADNc:1446bp
Description du ADNc:Full length Clone DNA of Homo sapiens lipopolysaccharide binding protein with N terminal HA tag.
Synonyme du gène:MGC22233
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humain Lipopolysaccharide binding Protéine/LBP expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur on other vectors
Humain Lipopolysaccharide binding Protéine/LBP expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10526-ACGCHF270
Humain Lipopolysaccharide binding Protéine/LBP expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10526-ACRCHF270
Humain Lipopolysaccharide binding Protéine/LBP expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10526-CFCHF230
Humain Lipopolysaccharide binding Protéine/LBP expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10526-CHCHF230
Humain Lipopolysaccharide binding Protéine/LBP expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10526-CMCHF230
Humain Lipopolysaccharide binding Protéine/LBP expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10526-CYCHF230
Humain Lipopolysaccharide binding Protéine/LBP Gène ADNc clone le vecteur de clonageHG10526-MCHF90
Humain Lipopolysaccharide binding Protéine/LBP expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10526-M-FCHF230
Humain Lipopolysaccharide binding Protéine/LBP expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10526-NFCHF230
Humain Lipopolysaccharide binding Protéine/LBP expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10526-NHCHF230
Humain Lipopolysaccharide binding Protéine/LBP expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10526-NMCHF230
Humain Lipopolysaccharide binding Protéine/LBP expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10526-NYCHF230
Humain Lipopolysaccharide binding Protéine/LBP expression plasmide de Gène l'ADNc ORF cloneHG10526-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Lipopolysaccharide binding protein ( LBP ) is a glycoprotein that is synthesized principally by hepatocytes. LBP is a trace plasma protein that binds to the lipid A moiety of bacterial lipopolysaccharides ( LPSs ). LBP binds directly to the outer membrane of Gram-negative bacteria and to purified aggregates of extracted endotoxin, and catalyses the delivery of endotoxin to membrane ( mCD14,GPI-Linked ) and soluble ( sCD14 ) forms of CD14, thereby markedly increasing host cell sensitivity to endotoxin. LBP efficiently catalyses the transfer of individual molecules of endotoxin to (s)CD14 only when LBP–endotoxin aggregates are formed in the presence of albumin. In the presence of EDTA, LBP binding promotes further disaggregation of endotoxin. LBP binding does not have such drastic effects under more physiological conditions, but may still induce more subtle topological rearrangements of endotoxin.

  • J. Weiss, 2003, Biochemical Society Transactions: Volume 31, part 4: 785-790.
  • RR Schumann, et al., Science, 1990, Vol 249, Issue 4975: 1429-143.
  • Carsten J. Kirschning, et al., 1997, Genomics, Volume 46, Issue 3: 416-25.
  • Size / Price
    Catalogue : HG10526-NY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.