After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain LCP2/SLP-76 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human LCP2 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_005565.3
Taille du ADNc:1602bp
Description du ADNc:Full length Clone DNA of Homo sapiens lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa) with C terminal Myc tag.
Synonyme du gène:SLP76, SLP-76, LCP2
Espèces:Human
Vecteur:pCMV3-C-Myc
Plasmid:
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humain LCP2/SLP-76 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur on other vectors
Humain LCP2/SLP-76 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG11237-ACGCHF290
Humain LCP2/SLP-76 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG11237-ACRCHF290
Humain LCP2/SLP-76 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG11237-ANGCHF290
Humain LCP2/SLP-76 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG11237-ANRCHF290
Humain LCP2/SLP-76 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11237-CFCHF260
Humain LCP2/SLP-76 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG11237-CHCHF260
Humain LCP2/SLP-76 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG11237-CMCHF260
Humain LCP2/SLP-76 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG11237-CYCHF260
Humain LCP2/SLP-76 Gène ADNc clone le vecteur de clonageHG11237-MCHF90
Humain LCP2/SLP-76 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11237-M-FCHF260
Humain LCP2/SLP-76 expression plasmide de Gène l'ADNc ORF cloneHG11237-M-NCHF260
Humain LCP2/SLP-76 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG11237-NFCHF260
Humain LCP2/SLP-76 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG11237-NHCHF260
Humain LCP2/SLP-76 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG11237-NMCHF260
Humain LCP2/SLP-76 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG11237-NYCHF260
Humain LCP2/SLP-76 expression plasmide de Gène l'ADNc ORF cloneHG11237-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG11237-CM
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
Images
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »