After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain LCP2/SLP-76 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human LCP2 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_005565.3
Taille du ADNc:1602bp
Description du ADNc:Full length Clone DNA of Homo sapiens lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa) with N terminal Flag tag.
Synonyme du gène:SLP76, SLP-76, LCP2
Espèces:Human
Vecteur:pCMV3-N-FLAG
Plasmid:
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humain LCP2/SLP-76 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur on other vectors
Humain LCP2/SLP-76 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG11237-ACGCHF290
Humain LCP2/SLP-76 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG11237-ACRCHF290
Humain LCP2/SLP-76 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG11237-ANGCHF290
Humain LCP2/SLP-76 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG11237-ANRCHF290
Humain LCP2/SLP-76 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11237-CFCHF260
Humain LCP2/SLP-76 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG11237-CHCHF260
Humain LCP2/SLP-76 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG11237-CMCHF260
Humain LCP2/SLP-76 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG11237-CYCHF260
Humain LCP2/SLP-76 Gène ADNc clone le vecteur de clonageHG11237-MCHF90
Humain LCP2/SLP-76 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11237-M-FCHF260
Humain LCP2/SLP-76 expression plasmide de Gène l'ADNc ORF cloneHG11237-M-NCHF260
Humain LCP2/SLP-76 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG11237-NFCHF260
Humain LCP2/SLP-76 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG11237-NHCHF260
Humain LCP2/SLP-76 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG11237-NMCHF260
Humain LCP2/SLP-76 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG11237-NYCHF260
Humain LCP2/SLP-76 expression plasmide de Gène l'ADNc ORF cloneHG11237-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »