Commande rapide

Humain Galectin-13/LGALS13 expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human LGALS13 Informations sur les produits clonés de cDNA
Taille du ADNc:420bp
Description du ADNc:Full length Clone DNA of Homo sapiens lectin, galactoside-binding, soluble, 13 with C terminal HA tag.
Synonyme du gène:PP13, GAL13, PLAC8, LGALS13
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humain Galectin-13/LGALS13 expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur on other vectors
Humain Galectin-13/LGALS13 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG11139-ACGCHF270
Humain Galectin-13/LGALS13 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG11139-ACRCHF270
Humain Galectin-13/LGALS13 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG11139-ANGCHF270
Humain Galectin-13/LGALS13 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG11139-ANRCHF270
Humain Galectin-13/LGALS13 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11139-CFCHF230
Humain Galectin-13/LGALS13 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG11139-CHCHF230
Humain Galectin-13/LGALS13 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG11139-CMCHF230
Humain Galectin-13/LGALS13 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG11139-CYCHF230
Humain Galectin-13/LGALS13 Gène ADNc clone le vecteur de clonageHG11139-MCHF90
Humain Galectin-13/LGALS13 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11139-M-FCHF230
Humain Galectin-13/LGALS13 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG11139-NFCHF230
Humain Galectin-13/LGALS13 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG11139-NHCHF230
Humain Galectin-13/LGALS13 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG11139-NMCHF230
Humain Galectin-13/LGALS13 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG11139-NYCHF230
Humain Galectin-13/LGALS13 expression plasmide de Gène l'ADNc ORF cloneHG11139-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG11139-CY
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.