After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Humain Galectin-14/LGALS14 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human LGALS14 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_020129.2
Taille du ADNc:420bp
Description du ADNc:Full length Clone DNA of Homo sapiens lectin, galactoside-binding, soluble, 14, transcript variant 1 with N terminal His tag.
Synonyme du gène:CLC2, PPL13, MGC22235, LGALS14
Espèces:Human
Vecteur:pCMV3-N-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humain Galectin-14/LGALS14 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
Humain Galectin-14/LGALS14 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG11371-ACGCHF270
Humain Galectin-14/LGALS14 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG11371-ACRCHF270
Humain Galectin-14/LGALS14 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG11371-ANGCHF270
Humain Galectin-14/LGALS14 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG11371-ANRCHF270
Humain Galectin-14/LGALS14 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11371-CFCHF230
Humain Galectin-14/LGALS14 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG11371-CHCHF230
Humain Galectin-14/LGALS14 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG11371-CMCHF230
Humain Galectin-14/LGALS14 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG11371-CYCHF230
Humain Galectin-14/LGALS14 transcript variant 1 Gène ADNc clone le vecteur de clonageHG11371-MCHF90
Humain Galectin-14/LGALS14 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11371-M-FCHF230
Humain Galectin-14/LGALS14 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG11371-NFCHF230
Humain Galectin-14/LGALS14 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG11371-NHCHF230
Humain Galectin-14/LGALS14 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG11371-NMCHF230
Humain Galectin-14/LGALS14 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG11371-NYCHF230
Humain Galectin-14/LGALS14 transcript variant 1 expression plasmide de Gène l'ADNc ORF cloneHG11371-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG11371-NH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
Images
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »