Commande rapide

Humain Galectin-9/LGALS9 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur

  • other Green fluorescent protein / GFP Gene Plasmid Map 5612
Fiche techniqueCommentairesProduits apparentésProtocoles
Humain LGALS9 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_002308.3
Taille du ADNc:1014 bp
Description du ADNc:Full length Clone DNA of Homo sapiens lectin, galactoside-binding, soluble, 9, transcript variant 2 with C terminal HA tag.
Synonyme du gène:HUAT, LGALS9A, MGC117375, MGC125973, MGC125974, LGALS9
Espèces:Human
Vecteur:pCMV3-C-HA
Plasmid:pCMV3-LGALS9-HA
Site de restriction:KpnI + XbaI(6kb+1.01kb)
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with LGALS9 qPCR primers for gene expression analysis, HP101056 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humain Galectin-9/LGALS9 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur on other vectors
Humain Galectin-9/LGALS9 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG11147-ACGCHF270
Humain Galectin-9/LGALS9 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG11147-ACRCHF270
Humain Galectin-9/LGALS9 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG11147-ANGCHF270
Humain Galectin-9/LGALS9 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG11147-ANRCHF270
Humain Galectin-9/LGALS9 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11147-CFCHF230
Humain Galectin-9/LGALS9 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG11147-CHCHF230
Humain Galectin-9/LGALS9 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG11147-CMCHF230
Humain Galectin-9/LGALS9 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG11147-CYCHF230
Humain Galectin-9/LGALS9 transcript variant 2 Gène ADNc clone le vecteur de clonageHG11147-MCHF90
Humain Galectin-9/LGALS9 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG11147-M-HCHF230
Humain Galectin-9/LGALS9 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG11147-NFCHF230
Humain Galectin-9/LGALS9 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG11147-NHCHF230
Humain Galectin-9/LGALS9 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG11147-NMCHF230
Humain Galectin-9/LGALS9 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG11147-NYCHF230
Humain Galectin-9/LGALS9 transcript variant 2 expression plasmide de Gène l'ADNc ORF cloneHG11147-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

The galectins are a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. The protein encoded by this gene is an S-type lectin. It is overexpressed in Hodgkin's disease tissue and might participate in the interaction between the H&RS cells with their surrounding cells and might thus play a role in the pathogenesis of this disease and/or its associated immunodeficiency. Multiple alternatively spliced transcript variants have been found for this gene.

Immune Checkpoint
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Size / Price
Catalogue : HG11147-CY
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
DisponibilitéIn Stock
Ajouter au panierBulk Discount Requiry

Datasheet & Documentation

Contact Us
    Articles consultés récemment
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »