Commande rapide

Humain Legumain expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human LGMN Informations sur les produits clonés de cDNA
Taille du ADNc:1302bp
Description du ADNc:Full length Clone DNA of Homo sapiens legumain with N terminal His tag.
Synonyme du gène:AEP, LGMN1, PRSC1
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

The Mammalian Legumain, also known as LGMN, also called asparaginyl endopeptidase (AEP), is a cysteine protease belonging to peptidase family C13 with a strict specificity for hydrolysis of asparaginyl bonds. Known previously only from plants and invertebrates, Legumain is discovered as a lysosomal endopeptidase in mammals. Mammalian Legumain is a cysteine endopeptidase, inhibited by iodoacetamide and maleimides, but unaffected by compound E64. The Mammalian Legumain is involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal systems. Legumain has been observed to be highly expressed in several types of solid tumors. It was demonstrated in membrane-associated vesicles concentrated at the invadopodia of tumor cells and on cell surfaces where it colocalized with integrins. Legumain was demonstrated to activate progelatinase A. Cells overexpressing Legumain possessed increased migratory and invasive activity in vitro and adopted an invasive and metastatic phenotype in vivo, inferring significance of Legumain in tumor invasion and metastasis. In addition, Legumain is expressed in both murine and human atherosclerotic lesions. The macrophage-specific expression of Legumain in vivo and ability of Legumain to induce chemotaxis of monocytes and endothelial cells in vitro suggest that Legumain may play a functional role in atherogenesis.

  • Schwarz G, et al. (2002) Characterization of legumain. Biol Chem. 383(11): 1813-6.
  • Liu C, et al. (2003) Overexpression of legumain in tumors is significant for invasion/metastasis and a candidate enzymatic target for prodrug therapy. Cancer Res. 63(11): 2957-64.
  • Murthy RV, et al. (2005) Legumain expression in relation to clinicopathologic and biological variables in colorectal cancer. Clin Cancer Res. 11(6): 2293-9.
  • Gawenda J, et al. (2007) Legumain expression as a prognostic factor in breast cancer patients. Breast Cancer Res Treat. 102(1): 1-6.
  • Clerin V, et al. (2007) Expression of the cysteine protease legumain in vascular lesions and functional implications in atherogenesis. Atherosclerosis. 201(1): 53-66.
  • Lew?“n S, et al. (2008) A Legumain-based minigene vaccine targets the tumor stroma and suppresses breast cancer growth and angiogenesis. Cancer Immunol Immunother. 57(4): 507-15.
  • Size / Price
    Catalogue : HG12846-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.