Commande rapide

Text Size:AAA

Humain LSM1 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human LSM1 Informations sur les produits clonés de cDNA
Taille du ADNc:402bp
Description du ADNc:Full length Clone DNA of Homo sapiens LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae) with C terminal Myc tag.
Synonyme du gène:CASM, YJL124C, LSM1
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

LSM1 is a Sm-like protein. Sm-like proteins can be detected in a variety of organisms based on sequence homology with the Sm protein family. Sm-like proteins include the Sm sequence motif, which consists of two regions separated by a linker of variable length that folds as a loop. The Sm-like proteins are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing. LSM1 has a role in replication-dependent histone mRNA degradation and binds specifically to the 3''-terminal U-tract of U6 snRNA. LSM1 also facilitates RNA protein interactions and structural modifications which are required during ribosomal subunit assembly.

  • Shimizu Y, et al. (1997) Lineage- and differentiation stage-specific expression of LSM-1 (LPAP), a possible substrate for CD45, in human hematopoietic cells. Am J Hematol. 54(1):1=11.
  • Graber MW, et al. (1997) CaSm: an Sm-like protein that contributes to the transformed state in cancer cells. Cancer Res. 57(14):2961-5.
  • Séraphin B, et al. (1999) Sm and Sm-like proteins assemble in two related complexes of deep evolutionary origin. EMBO J. 18(12):3451-62.
  • Size / Price
    Catalogue : HG14142-CM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.