Commande rapide

Text Size:AAA

Humain LTBR/TNFRSF3 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human LTBR Informations sur les produits clonés de cDNA
Taille du ADNc:1308bp
Description du ADNc:Full length Clone DNA of Homo sapiens lymphotoxin beta receptor (TNFR superfamily, member 3) with C terminal Myc tag.
Synonyme du gène:CD18, TNFCR, D12S370, TNFR-RP, TNFRSF3, TNFR2-RP, LT-BETA-R, TNF-R-III
Site de restriction:HindIII + XbaI (6kb + 1.36kb)
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 516 A>C not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human LTBR Gene Plasmid Map
Human LTBR / TNFRSF3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

LTBR (lymphotoxin beta receptor (TNFR superfamily, member 3)) is a member of the tumor necrosis factor (TNF) family of receptors. Tumor necrosis factor receptor is a trimeric cytokine receptor that binds tumor necrosis factors. The receptor cooperates with an adaptor protein (such as TRADD, TRAF, RIP), which is important in determining the outcome of the response. LTBR is expressed on the surface of most cell types, including cells of epithelial and myeloid lineages, but not on T and B lymphocytes. LTBR specifically binds the lymphotoxin membrane form (a complex of lymphotoxin-alpha and lymphtoxin-beta). LTBR and its ligand play a role in the development and organization of lymphoid tissue and tranformed cells. Activation of this protein can trigger apoptosis. Not only does the LTBR help trigger apoptosis, it can lead to the release of the cytokine interleukin 8. Overexpression of LTBR in HEK293 cells increases IL-8 promoter activity and leads to IL-8 release. It is also essential for development and organization of the secondary lymphoid organs and chemokine release.

  • Summers deLuca L, et al. (2011) A LTβR signaling in dendritic cells induces a type I IFN response that is required for optimal clonal expansion of CD8+ T cells. Proc Natl Acad Sci. 108(5):2046-51.
  • Bista P, et al. (2010) TRAF3 controls activation of the canonical and alternative NFkappaB by the lymphotoxin beta receptor. J Biol Chem. 285(17):12971-8.
  • Xu Y, et al. (2011) Adiponectin inhibits lymphotoxin-β receptor-mediated NF-κB signaling in human umbilical vein endothelial cells. Biochem Biophys Res Commun. 404(4):1060-4.
  • Size / Price
    Catalogue : HG10581-CM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    DisponibilitéIn Stock
    Bulk Discount RequiryAjouter au panier
    Contact Us
    • Human LTBR / TNFRSF3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.