After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain Lysozyme 2 / LYZL2 expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human LYZL2 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC066294
Taille du ADNc:585bp
Description du ADNc:Full length Clone DNA of Homo sapiens lysozyme-like 2 with N terminal Myc tag.
Synonyme du gène:LYZL2
Espèces:Human
Vecteur:pCMV3-SP-N-Myc
Plasmid:
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Fond

Lysozyme 2 gene is a member of a family of lysozyme-like genes. Lysozymes, especially C-type lysozymes, are well-recognized bacteriolytic factors widely distributed in the animal kingdom and play a mainly protective role in host defense. Lysozymes damage bacterial cell walls by catalyzing hydrolysis of 1,4-beta-linkages between N-acetylmuramic acid and N-acetyl-D-glucosamine residues in a peptidoglycan and between N-acetyl-D-glucosamine residues in chitodextrins.

Lysozyme is part of the innate immune system. Reduced lysozyme levels have been associated with bronchopulmonary dysplasia in newborns. In certain cancers (especially myelomonocytic leukemia) excessive production of lysozyme by cancer cells can lead to toxic levels of lysozyme in the blood. High lysozyme blood levels can lead to kidney failure and low blood potassium, conditions that may improve or resolve with treatment of the primary malignancy.

Références
  • Lamesch P. et al., 2007, Genomics. 89 (3): 307-15.
  • Argyropoulos G. et al., 2009, Physiol Genomics. 36 (2): 79-88.
  • Deloukas P. et al., 2004, Nature. 429 (6990): 375-81.
  • Size / Price
    Catalogue : HG13726-NM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »