MAP2 cDNA ORF Clone, Human, C-His tag

Price:
Size:
Number:

MAP2 cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1680 bp
Description
Full length Clone DNA of Human microtubule-associated protein 2 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

MAP2 cDNA ORF Clone, Human, C-His tag: Alternative Names

MAP2A cDNA ORF Clone, Human; MAP2B cDNA ORF Clone, Human; MAP2C cDNA ORF Clone, Human

MAP2 Background Information

Microtubule-associated protein-2 (MAP2) is the most abundant MAP in neurons, where its distribution is restricted to the somatodendritic compartment. This molecule undergoes developmentally regulated alternative splicing, resulting in at least two isoforms, a juvenile isoform (termed MAP2c) and a mature isoform (MAP2), with greatly different molecular masses.Microtubule-associated protein 2 (MAP2) is a major component of the neuronal cytoskeleton and is known to promote the assembly and stabilization of microtubules, functions which have important implications in neuronal differentiation.
Full Name
microtubule-associated protein 2
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait