MAP2 cDNA ORF Clone, Human, N-Myc tag

1/1
Price:
Size:
Number:

MAP2 cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1725 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human microtubule-associated protein 2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
HindIII + NotI(6kb+1.73kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

MAP2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MAP2 cDNA ORF Clone, Human, N-Myc tag: Validated Images

MAP2 cDNA ORF Clone, Human, N-Myc tag: Alternative Names

MAP2A cDNA ORF Clone, Human; MAP2B cDNA ORF Clone, Human; MAP2C cDNA ORF Clone, Human

MAP2 Background Information

Microtubule-associated protein-2 (MAP2) is the most abundant MAP in neurons, where its distribution is restricted to the somatodendritic compartment. This molecule undergoes developmentally regulated alternative splicing, resulting in at least two isoforms, a juvenile isoform (termed MAP2c) and a mature isoform (MAP2), with greatly different molecular masses.Microtubule-associated protein 2 (MAP2) is a major component of the neuronal cytoskeleton and is known to promote the assembly and stabilization of microtubules, functions which have important implications in neuronal differentiation.
Full Name
microtubule-associated protein 2
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait