After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain TPL2/MAP3K8/MEKK8 expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human MAP3K8 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_005204.2
Taille du ADNc:1404bp
Description du ADNc:Full length Clone DNA of Homo sapiens mitogen-activated protein kinase kinase kinase 8 with N terminal Myc tag.
Synonyme du gène:COT, EST, ESTF, TPL2, Tpl-2, c-COT, FLJ10486
Espèces:Human
Vecteur:pCMV3-N-Myc
Plasmid:
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humain TPL2/MAP3K8/MEKK8 expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur on other vectors
Humain TPL2/MAP3K8/MEKK8 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10800-ACGCHF270
Humain TPL2/MAP3K8/MEKK8 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10800-ACRCHF270
Humain TPL2/MAP3K8/MEKK8 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10800-ANGCHF270
Humain TPL2/MAP3K8/MEKK8 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10800-ANRCHF270
Humain TPL2/MAP3K8/MEKK8 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10800-CFCHF230
Humain TPL2/MAP3K8/MEKK8 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10800-CHCHF230
Humain TPL2/MAP3K8/MEKK8 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10800-CMCHF230
Humain TPL2/MAP3K8/MEKK8 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10800-CYCHF230
Humain TPL2/MAP3K8/MEKK8 Gène ADNc clone le vecteur de clonageHG10800-MCHF90
Humain TPL2/MAP3K8/MEKK8 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10800-M-HCHF230
Humain TPL2/MAP3K8/MEKK8 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10800-NFCHF230
Humain TPL2/MAP3K8/MEKK8 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10800-NHCHF230
Humain TPL2/MAP3K8/MEKK8 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10800-NMCHF230
Humain TPL2/MAP3K8/MEKK8 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10800-NYCHF230
Humain TPL2/MAP3K8/MEKK8 expression plasmide de Gène l'ADNc ORF cloneHG10800-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

Mitogen-activated protein kinase kinase kinase 8, also known as Cancer Osaka thyroid oncogene, Proto-oncogene c-Cot, Serine/threonine-protein kinase cot, Tumor progression locus 2 and MAP3K8, is a cytoplasm protein which belongs to the protein kinase superfamily, STE Ser/Thr protein kinase family and MAP kinase kinase kinase subfamily. MAP3K8 is expressed in several normal tissues and human tumor-derived cell lines. Isoform 1 of MAP3K8 is activated specifically during the S and G2/M phases of the cell cycle. MAP3K8 is required for TLR4 activation of the MEK/ERK pathway. It is able to activate NF-kappa-B 1 by stimulating proteasome-mediated proteolysis of NF-kappa-B 1/p105. MAP3K8 plays a role in the cell cycle. The longer form has some transforming activity, although it is much weaker than the activated cot oncoprotein. MAP3K8 oncogene linked to human endometrial carcinoma suggesting that it may be another molecule involved in human endometrial cancer. MAP3K8 may also be an important mediator of intracellular mechanotransduction in human bone marrow-derived mesenchymal stem cells (MSCs).

Références
  • Clark,A.M. et al., 2004, Genes Chromosomes Cancer. 41 (2):99-108.
  • Chan,H. et al., 2005, Biochem Biophys Res Commun. 328 (1):198-205.
  • Aparecida Alves,C. et al., 2006, Eur J Gynaecol Oncol. 27 (6):589-93.
  • Mielke,L.A. et al., 2009, J Immunol. 183 (12):7984-93.
  • Glossop,J.R. et al., 2009,Gene Expr Patterns  9 (5):381-8. 
  • Size / Price
    Catalogue : HG10800-NM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »