MAP3K8 cDNA ORF Clone, Human, C-His tag

Price:
Size:
Number:

MAP3K8 cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1404 bp
Description
Full length Clone DNA of Human mitogen-activated protein kinase kinase kinase 8 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

MAP3K8 cDNA ORF Clone, Human, C-His tag: Alternative Names

AURA2 cDNA ORF Clone, Human; c-COT cDNA ORF Clone, Human; COT cDNA ORF Clone, Human; EST cDNA ORF Clone, Human; ESTF cDNA ORF Clone, Human; MEKK8 cDNA ORF Clone, Human; Tpl-2 cDNA ORF Clone, Human; TPL2 cDNA ORF Clone, Human

MAP3K8 Background Information

Mitogen-activated protein kinase kinase kinase 8, also known as Cancer Osaka thyroid oncogene, Proto-oncogene c-Cot, Serine/threonine-protein kinase cot, Tumor progression locus 2 and MAP3K8, is a cytoplasm protein which belongs to theprotein kinase superfamily, STE Ser/Thr protein kinase family and MAP kinase kinase kinase subfamily. MAP3K8 is expressed in several normal tissues and human tumor-derived cell lines. Isoform1of MAP3K8 is activated specifically during the S and G2/M phases of the cell cycle. MAP3K8 is required for TLR4 activation of the MEK/ERK pathway. It is able to activate NF-kappa-B 1 by stimulating proteasome-mediated proteolysis of NF-kappa-B 1/p15. MAP3K8 plays a role in the cell cycle. The longer form has some transforming activity, although it is much weaker than the activated cot oncoprotein. MAP3K8 oncogene linked to human endometrial carcinoma suggesting that it may be another molecule involved in human endometrial cancer. MAP3K8 may also be an important mediator of intracellular mechanotransduction in human bone marrow-derived mesenchymal stem cells (MSCs).
Full Name
mitogen-activated protein kinase kinase kinase 8
References
  • Clark,A.M. et al., 2004, Genes Chromosomes Cancer. 41 (2):99-108.
  • Chan,H. et al., 2005, Biochem Biophys Res Commun. 328 (1):198-205.
  • Aparecida Alves,C. et al., 2006, Eur J Gynaecol Oncol. 27 (6):589-93.
  • Mielke,L.A. et al., 2009, J Immunol. 183 (12):7984-93.
  • Glossop,J.R. et al., 2009,Gene Expr Patterns  9 (5):381-8. 
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait