Commande rapide

Humain p38 delta/MAPK13 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Humain MAPK13 Informations sur les produits clonés de cDNA
    Taille du ADNc:1098bp
    Description du ADNc:Full length Clone DNA of Homo sapiens mitogen-activated protein kinase 13 with N terminal His tag.
    Synonyme du gène:SAPK4, PRKM13, MGC99536, p38delta, MAPK13
    Site de restriction:
    Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Description de la séquence:
    ( We provide with MAPK13 qPCR primers for gene expression analysis, HP100680 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Humain p38 delta/MAPK13 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
    Humain p38 delta/MAPK13 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10747-ACGCHF270
    Humain p38 delta/MAPK13 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10747-ACRCHF270
    Humain p38 delta/MAPK13 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10747-ANGCHF270
    Humain p38 delta/MAPK13 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10747-ANRCHF270
    Humain p38 delta/MAPK13 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10747-CFCHF230
    Humain p38 delta/MAPK13 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10747-CHCHF230
    Humain p38 delta/MAPK13 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10747-CMCHF230
    Humain p38 delta/MAPK13 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10747-CYCHF230
    Humain p38 delta/MAPK13 Gène ADNc clone le vecteur de clonageHG10747-MCHF90
    Humain p38 delta/MAPK13 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10747-M-FCHF230
    Humain p38 delta/MAPK13 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10747-NFCHF230
    Humain p38 delta/MAPK13 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10747-NHCHF230
    Humain p38 delta/MAPK13 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10747-NMCHF230
    Humain p38 delta/MAPK13 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10747-NYCHF230
    Humain p38 delta/MAPK13 expression plasmide de Gène l'ADNc ORF cloneHG10747-UTCHF230
     En savoir plus sur les vecteurs d'expression
    Product nameProduct name

    The p38 family of mitogen-activated protein kinases (MAPK) includes p38 alpha (SAPK2a, CSBP), p38 beta (SAPK2b), p38 delta (SAPK4), and p38 gamma (SAPK3/ERK6). p38 alpha and p38 beta are widely expressed p38 isoforms that are involved in regulation of cell proliferation, differentiation, development, and response to stress. p38 delta, also known as MAPK13, is a regulator of differentiation-dependent gene expression in keratinocytes, and been as a regulator of surface epithelia differentiation and apoptosis. p38 delta protein is upregulated in Cholangiocarcinoma (CC) relative to hepatocellularcarcinoma (HCC) and to normal biliary tract tissues. p38 delta is important for motility and invasion of CC cells, suggesting that p38 delta may play an important role in CC metastasis. p38 delta is expressed in the epidermis, suggesting a role for p38 delta in regulating differentiation. p38 delta is the major p38 isoform driving suprabasal involucrin gene expression and that p38 delta directly regulates ERK1/2 activity via formation of a p38 delta-ERK1/2 complex. Recent emerging evidence suggests that the p38 stress MAPK pathway may function as a tumor suppressor through regulating Ras-dependent and -independent proliferation, transformation, invasion and cell death by isoform-specific mechanisms. p38 delta has important role in promoting cell proliferation and tumor development in epidermis and may have therapeutic implication for skin cancer.

  • Efimova T, et al. (2003) A regulatory role for p38 delta MAPK in keratinocyte differentiation. Evidence for p38 delta-ERK1/2 complex formation. J Biol Chem. 278(36): 34277-85.
  • Eckert RL, et al. (2003) p38 Mitogen-activated protein kinases on the body surface--a function for p38 delta. J Invest Dermatol. 120(5): 823-8.
  • Loesch M, et al. (2008) The p38 MAPK stress pathway as a tumor suppressor or more? Front Biosci. 13: 3581-93.
  • Schindler EM, et al. (2009) p38delta Mitogen-activated protein kinase is essential for skin tumor development in mice. Cancer Res. 69(11): 4648-55.
  • Tan FL, et al. (2010) p38delta/MAPK13 as a diagnostic marker for cholangiocarcinoma and its involvement in cell motility and invasion. Int J Cancer. 126(10): 2353-61.
  • Size / Price
    Catalogue : HG10747-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.