Commande rapide

Humain JNK1 / MAPK8 transcript variant JNK1-b2 expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human MAPK8 Informations sur les produits clonés de cDNA
Taille du ADNc:1284bp
Description du ADNc:Full length Clone DNA of Homo sapiens mitogen-activated protein kinase 8, transcript variant JNK1-b2 with N terminal Myc tag.
Synonyme du gène:JNK, JNK1, PRKM8, SAPK1, JNK1A2, JNK21B1/2
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humain JNK1 / MAPK8 transcript variant JNK1-b2 expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur on other vectors
Humain JNK1 / MAPK8 transcript variant JNK1-b2 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10795-ACGCHF270
Humain JNK1 / MAPK8 transcript variant JNK1-b2 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10795-ACRCHF270
Humain JNK1 / MAPK8 transcript variant JNK1-b2 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10795-ANGCHF270
Humain JNK1 / MAPK8 transcript variant JNK1-b2 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10795-ANRCHF270
Humain JNK1 / MAPK8 transcript variant JNK1-b2 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10795-CFCHF230
Humain JNK1 / MAPK8 transcript variant JNK1-b2 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10795-CHCHF230
Humain JNK1 / MAPK8 transcript variant JNK1-b2 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10795-CMCHF230
Humain JNK1 / MAPK8 transcript variant JNK1-b2 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10795-CYCHF230
Humain JNK1 / MAPK8 transcript variant JNK1-b2 Gène ADNc clone le vecteur de clonageHG10795-MCHF90
Humain JNK1 / MAPK8 transcript variant JNK1-b2 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10795-M-FCHF230
Humain JNK1 / MAPK8 transcript variant JNK1-b2 expression plasmide de Gène l'ADNc ORF cloneHG10795-M-NCHF230
Humain JNK1 / MAPK8 transcript variant JNK1-b2 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10795-NFCHF230
Humain JNK1 / MAPK8 transcript variant JNK1-b2 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10795-NHCHF230
Humain JNK1 / MAPK8 transcript variant JNK1-b2 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10795-NMCHF230
Humain JNK1 / MAPK8 transcript variant JNK1-b2 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10795-NYCHF230
Humain JNK1 / MAPK8 transcript variant JNK1-b2 expression plasmide de Gène l'ADNc ORF cloneHG10795-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Mitogen-activated protein kinase 8 (MAPK8), also known as JNK1, is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. The protein kinases JNK1 has been found to serve as critical molecular links between obesity, metabolic inflammation, and disorders of glucose homeostasis. It is critically involved in the promotion of diet-induced obesity, metabolic inflammation and beta-cell dysfunction. The selective deficiency of JNK1 in the murine nervous system is sufficient to suppress diet-induced obesity. Genetic analysis indicates that the effects of JNK1 can be separated from effects of JNK1 on obesity. JNK1 is a potential pharmacological target for the development of drugs that might be useful for the treatment of metabolic syndrome, and type 2 diabetes. Furthermore, JNK1 plays a major role in the hypoxic cellular damage. JNK1 protein might be an attractive target for antihypoxic therapy in increasing resistance to many pathological conditions and diseases, leading to the oxygen deficit.

  • Betigeri S, et al. (2006) JNK1 as a molecular target to limit cellular mortality under hypoxia. Mol Pharm. 3(4): 424-30.
  • Solinas G, et al. (2010) JNK1 and IKKbeta: molecular links between obesity and metabolic dysfunction. FASEB J. 24(8): 2596-611.
  • Sabio G, et al. (2010) Role of the hypothalamic-pituitary-thyroid axis in metabolic regulation by JNK1. Genes Dev. 24(3): 256-64.
  • Size / Price
    Catalogue : HG10795-NM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.