After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain MEK1/MAP2K1/MKK1 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Human MAP2K1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_002755.3
Taille du ADNc:1182bp
Description du ADNc:Full length Clone DNA of Homo sapiens mitogen-activated protein kinase kinase 1.
Synonyme du gène:MEK1, MKK1, MAPKK1, PRKMK1, MAP2K1
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Humain MEK1/MAP2K1/MKK1 expression plasmide de Gène l'ADNc ORF clone on other vectors
Humain MEK1/MAP2K1/MKK1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10661-ACGCHF270
Humain MEK1/MAP2K1/MKK1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10661-ACRCHF270
Humain MEK1/MAP2K1/MKK1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10661-ANGCHF270
Humain MEK1/MAP2K1/MKK1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10661-ANRCHF270
Humain MEK1/MAP2K1/MKK1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10661-CFCHF230
Humain MEK1/MAP2K1/MKK1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10661-CHCHF230
Humain MEK1/MAP2K1/MKK1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10661-CMCHF230
Humain MEK1/MAP2K1/MKK1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10661-CYCHF230
Humain MEK1/MAP2K1/MKK1 Gène ADNc clone le vecteur de clonageHG10661-MCHF90
Humain MEK1/MAP2K1/MKK1 expression plasmide de Gène l'ADNc ORF cloneHG10661-M-NCHF230
Humain MEK1/MAP2K1/MKK1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10661-NFCHF230
Humain MEK1/MAP2K1/MKK1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10661-NHCHF230
Humain MEK1/MAP2K1/MKK1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10661-NMCHF230
Humain MEK1/MAP2K1/MKK1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10661-NYCHF230
Humain MEK1/MAP2K1/MKK1 expression plasmide de Gène l'ADNc ORF cloneHG10661-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

MEK1, also known as MAP2K1 and MKK1, is a member of the dual specificity protein kinase family, which acts as a mitogen-activated protein (MAP) kinase kinase. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals. MEK1 is widely expressed, with extremely low levels in brain. It lies upstream of MAP kinases and stimulates the enzymatic activity of MAP kinases upon wide variety of extra- and intracellular signals. As an essential component of MAP kinase signal transduction pathway, MEK1 is involved in many cellular processes such as proliferation, differentiation, transcription regulation and development. Binding extracellular ligands such as growth factors, cytokines and hormones to their cell-surface receptors activates RAS and this initiates RAF1 activation. RAF1 then further activates the dual-specificity protein kinases MAP2K1 and MEK2. MEK1 has been shown to export PPARG from the nucleus. The MAPK cascade is also involved in the regulation of endosomal dynamics, including lysosome processing and endosome cycling through the perinuclear recycling compartment (PNRC), as well as in the fragmentation of the Golgi apparatus during mitosis. MKK1 catalyzes the concomitant phosphorylation of a threonine and a tyrosine residue in a Thr-Glu-Tyr sequence located in MAP kinases. Defects in MEK1 can cause cardiofaciocutaneous syndrome.

Références
  • Rampoldi L, et al. (1998) Chromosomal localization of four MAPK signaling cascade genes: MEK1, MEK3, MEK4 and MEKK5. Cytogenet Cell Genet. 78(3-4):301-3.
  • Zheng CF, et al. (1993) Cloning and characterization of two distinct human extracellular signal-regulated kinase activator kinases, MEK1 and MEK2. J Biol Chem. 268(15):11435-9.
  • Nantel, et al. (1998) Interaction of the Grb10 adapter protein with the Raf1 and MEK1 kinases. J Biol Chem. 273(17):10475-84.
  • Hirata H, et al. (2012) I MicroRNA-1826 targets VEGFC, beta-catenin (CTNNB1) and MEK1 (MAP2K1) in human bladder cancer. Carcinogenesis. 33(1):41-8.
  • Size / Price
    Catalogue : HG10661-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »