MFGE8 cDNA ORF Clone, Human, N-HA tag

Price:
Size:
Number:

MFGE8 cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1164 bp
Description
Full length Clone DNA of Human milk fat globule-EGF factor 8 protein with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

MFGE8 cDNA ORF Clone, Human, N-HA tag: Alternative Names

BA46 cDNA ORF Clone, Human; EDIL1 cDNA ORF Clone, Human; HMFG cDNA ORF Clone, Human; hP47 cDNA ORF Clone, Human; HsT19888 cDNA ORF Clone, Human; MFG-E8 cDNA ORF Clone, Human; MFGM cDNA ORF Clone, Human; OAcGD3S cDNA ORF Clone, Human; SED1 cDNA ORF Clone, Human; SPAG10 cDNA ORF Clone, Human

MFGE8 Background Information

MFG-E8, also known as lactadherin and MFGE8, contains 1 EGF-like domain and 2 F5/8 type C domains. It also contains a phosphatidylserine (PS) binding domain, as well as an Arginine-Glycine-Aspartic acid motif, which enables the binding to integrins. It binds PS, which is exposed on the surface of apoptotic cells. MFG-E8 is expressed in mammary epithelial cell surfaces and aortic media. Overexpression of MFG-E8 can be found in several carcinomas. MFG-E8 has an opsonization of the apoptotic cells and binding to integrins on the surface of phagocytic cells. It also mediates the engulfment of the dead cell. MFG-E8 plays an important role in the maintenance of intestinal epithelial homeostasis and the promotion of mucosal healing. It promotes VEGF-dependent neovascularization and contributes to phagocytic removal of apoptotic cells in many tissues. It also binds to phosphatidylserine-enriched cell surfaces in a receptor-independent manner.
Full Name
milk fat globule-EGF factor 8 protein
References
  • Oshima K, et al. (2002) Secretion of a peripheral membrane protein, MFG-E8, as a complex with membrane vesicles. Eur J Biochem. 269(4):1209-18.
  • Hanayama R, et al. (2002) Identification of a factor that links apoptotic cells to phagocytes. Nature. 417 (6885):182-7.
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait