Motilin cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

Motilin cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
348 bp
Description
Full length Clone DNA of Human motilin with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Motilin cDNA ORF Clone, Human, N-Myc tag: Alternative Names

MLN cDNA ORF Clone, Human; Motilin cDNA ORF Clone, Human

Motilin Background Information

MLN have characteristics between nanostructured lipid carriers (NLC) and multiple emulsions (W/O/W), but without the outer aqueous phase.The anticancer small molecule MLN4924, a Nedd8-activating enzyme (NAE) inhibitor, triggers cell-cycle arrest, apoptosis, and senescence in cancer cells. MLN 944 is a bisintercalating DNA-binding antitumor agent known to be a template inhibitor of transcription.MLN-591 is a monoclonal antibody specific for prostate-specific membrane antigen that is being developed by Cornell University, BZL Biologics, ImmunoGen Inc and Millennium Pharmaceuticals Inc for the potential treatment of prostate cancer.
Full Name
motilin
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait