Commande rapide

Humain MOB1B / MOBKL1A expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Humain MOB1B Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:BC038112
    Taille du ADNc:651bp
    Description du ADNc:Full length Clone DNA of Homo sapiens MOB kinase activator 1B with C terminal His tag.
    Synonyme du gène:MATS2, MOB4A, MOBKL1A
    Espèces:Human
    Vecteur:pCMV3-C-His
    Plasmid:
    Site de restriction:
    Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with MOB1B qPCR primers for gene expression analysis, HP102672 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Humain MOB1B / MOBKL1A expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
    Product nameProduct name
    Fond

    MST1 and MST2 are the mammalian Ste20-related protein kinases most closely related to Drosophila Hippo, a major regulator of cell proliferation and survival during development. Overexpression of MST1 or MST2 in mammalian cells is proapototic. MST1 and MST2 activity increases during mitosis, especially in nocodazole-arrested mitotic cells, where these kinases exhibit both an increase in both abundance and activation. MST1 and MST2 also can be activated nonphysiologically by okadaic acid or H2O2. The MOB1B and MOBKL1B polypeptides, homologs of the Drosophila MATS polypeptide, are identified as preferred MST1/MST2 substrates in vitro and are phosphorylated in cells in an MST1/MST2-dependent manner in mitosis and in response to okadaic acid or H2O2. MST1/MST2-catalyzed MOB1B/MOBKL1B phosphorylation alters the ability of MOB1B/MOBKL1B to bind and regulate downstream targets such as the NDR-family protein kinases. Thus, MOB1B/MOBKL1B phosphorylation in cells promotes MOB1B/MOBKL1B binding to the LATS1 kinase and enables H2O2-stimulated LATS1 activation loop phosphorylation. Most importantly, replacement of endogenous MOB1B/MOBKL1B by a nonphosphorylatable mutant is sufficient to accelerate cell proliferation substantially by speeding progression through G1/S as well as mitotic exit.

    Références
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36(1):40-5.
  • Gerhard DS, et al. (2004) The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 14(10B):2121-7.
  • Devroe E, et al. (2004) Human Mob proteins regulate the NDR1 and NDR2 serine-threonine kinases. J Biol Chem. 279(23):24444-51.
  • Praskova M, et al. (2008) MOB1B/MOBKL1B phosphorylation by MST1 and MST2 inhibits cell proliferation. Curr Biol. 18(5):311-21.
  • Size / Price
    Catalogue : HG14016-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »