MRPL44 cDNA ORF Clone, Human, C-Myc tag

Price:
Size:
Number:

MRPL44 cDNA ORF Clone, Human, C-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
999 bp
Description
Full length Clone DNA of Human mitochondrial ribosomal protein L44 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

MRPL44 cDNA ORF Clone, Human, C-Myc tag: Alternative Names

COXPD16 cDNA ORF Clone, Human; L44MT cDNA ORF Clone, Human; MRP-L44 cDNA ORF Clone, Human

MRPL44 Background Information

MRPL44 encodes a protein in the large subunit of the mitochondrial ribosome and is suggested to locate in close proximity to the tunnel exit of the yeast mitochondrial ribosome.In patient fibroblasts, decreased MRPL44 affected assembly of the large ribosomal subunit and stability of 16S rRNA leading to complex IV deficiency.MRPL44 may have a function in the assembly/stability of nascent mitochondrial polypeptides exiting the ribosome.
Full Name
mitochondrial ribosomal protein L44
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait