Commande rapide

Text Size:AAA

Humain MRTO4 / MRT4 expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human MRTO4 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC003013
Taille du ADNc:720bp
Description du ADNc:Full length Clone DNA of Homo sapiens mRNA turnover 4 homolog (S. cerevisiae) with N terminal HA tag.
Synonyme du gène:MRT4, C1orf33, dJ657E11.4
Espèces:Human
Vecteur:pCMV3-N-HA
Plasmid:
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Fond

MRTO4, also known as MRT4, belongs to the ribosomal protein L10P family. MRTO4 is a ribosomal P0-like protein showing extensive sequence similarity to the ribosomal P0 protein. The precise function of MRTO4 is currently unknown. It appears to be involved in mRNA turnover and ribosome assembly. MRTO4 acts as a trans-acting factor which modulates the assembly of the pre-60S particle.

Références
  • Zhao J. et al., 2011, J Proteomics. 75 (2): 588-602.
  • Havugimana PC. et al., 2012, Cell. 150 (5): 1068-81.
  • Wu Z. et al., 2012, PLoS One. 7 (8): e43997.
  • Michalec B. et al., 2010, Int J Biochem Cell Biol. 42 (5): 736-48.
  • Size / Price
    Catalogue : HG14639-NY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »