After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain MST4/MST-4 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Human MST4 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_016542.3
Taille du ADNc:1251bp
Description du ADNc:Full length Clone DNA of Homo sapiens serine/threonine protein kinase MST4.
Synonyme du gène:MST4, MASK
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Humain MST4/MST-4 expression plasmide de Gène l'ADNc ORF clone on other vectors
Humain MST4/MST-4 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10667-ACGCHF270
Humain MST4/MST-4 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10667-ACRCHF270
Humain MST4/MST-4 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10667-ANGCHF270
Humain MST4/MST-4 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10667-ANRCHF270
Humain MST4/MST-4 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10667-CFCHF230
Humain MST4/MST-4 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10667-CHCHF230
Humain MST4/MST-4 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10667-CMCHF230
Humain MST4/MST-4 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10667-CYCHF230
Humain MST4/MST-4 Gène ADNc clone le vecteur de clonageHG10667-MCHF90
Humain MST4/MST-4 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10667-M-FCHF230
Humain MST4/MST-4 expression plasmide de Gène l'ADNc ORF cloneHG10667-M-NCHF230
Humain MST4/MST-4 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10667-NFCHF230
Humain MST4/MST-4 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10667-NHCHF230
Humain MST4/MST-4 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10667-NMCHF230
Humain MST4/MST-4 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10667-NYCHF230
Humain MST4/MST-4 expression plasmide de Gène l'ADNc ORF cloneHG10667-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

MST4, also known as mammalian STE20-like protein kinase 4, is a novel member of the germinal center kinase subfamily of human Ste20-like kinases and is closely related to MST3. The 416 amino acid full-length MST4 contains a C-terminal regulatory domain and an N-terminal kinase domain, both of which are required for full activation of the kinase. MST4 is highly expressed in placenta, thymus, and peripheral blood leukocytes. MST4 specifically activates ERK but not JNK or p38 MAPK in transient transfected cells or in stable cell lines, and thus is biologically active in the activation of MEK/ERK pathway mediating cell growth and transformation. Further, MST4 kinase activity is stimulated significantly by epidermal growth factor receptor (EGFR) ligands, which are known to promote growth of certain cancer cells. Accordingly, MST4 have a potential role in signal transduction pathways involved in cancer progression. Three alternatively spliced isoform of MST4 have been isolated, and isoform 3 lacks an exon encoding kinase domain and may function as a dominant-negative regulator of the MST4 kinase.

Références

1. Qian, Z. et al., 2001, J Biol Chem. 276 :22439-45.

2. Lin, JL. et al., 2001, Oncogene. 20: 6559-6569.

3. Sung V, et al., 2003, Cancer research. 63: 3356-63.

4. Ma, X. et al., 2007, Molecular biology of the cell. 18:1965-78.

5. ten Klooster JP, et al., 2009, Developmental cell. 16:551-62.

Size / Price
Catalogue : HG10667-UT
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »