Commande rapide

Humain MTSS1 expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human MTSS1 Informations sur les produits clonés de cDNA
Taille du ADNc:2268bp
Description du ADNc:Full length Clone DNA of Homo sapiens metastasis suppressor 1 with N terminal Myc tag.
Synonyme du gène:MIM, MIMA, MIMB, FLJ44694, KIAA0429, DKFZp781P2223, MTSS1
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

MTSS1 (Metastasis suppressor 1), also known as Missing in metastasis (MIM), is a tissue-specific regulator of plasma membrane dynamics. MTSS1 is well described for its function as a metastasis suppressor gene and is expressed in a variety of tissues. MTSS1 might be involved in shaping neuronal membranes in vivo. MTSS1 deforms phosphoinositide-rich membranes through its I-BAR domain and interacts with actin monomers through its WH2 domain. MTSS1/MIM was first identified as a metastasis suppressor missing in metastatic bladder carcinoma cell lines. MTSS1 is a prognostic indicator of disease-free survival in breast cancer patients and demonstrates the ability to play a role in governing the metastatic nature of breast cancer cells. MTSS1 may serve as a useful biomarker for the prediction of outcome of gastric cancer. The down-regulation of MTSS1 that may be caused by DNA methylation was also observed in many other types of cancer.Recent work proposed that MIM also potentiates Sonic hedgehog (Shh)-induced gene expression. MTSS1 as a multiple functional molecular player and has an important role in development, carcinogenesis and metastasis.

  • Hayn-Leichsenring G, et al. (2011) Cellular distribution of metastasis suppressor 1 and the shape of cell bodies are temporarily altered in Engrailed-2 overexpressing cerebellar Purkinje cells. Neuroscience. 189: 68-78.
  • Xie F, et al. (2011) MTSS1: a multifunctional protein and its role in cancer invasion and metastasis. Front Biosci (Schol Ed). 3: 621-31.
  • Saarikangas J, et al. (2011) Missing-in-metastasis MIM/MTSS1 promotes actin assembly at intercellular junctions and is required for integrity of kidney epithelia. J Cell Sci. 2124(Pt 8): 1245-55.
  • Parr C, et al. (2009) Metastasis suppressor 1 (MTSS1) demonstrates prognostic value and anti-metastatic properties in breast cancer. Eur J Cancer. 45(9): 1673-83.
  • Size / Price
    Catalogue : HG13085-NM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.