After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain Mevalonate kinase / MVK expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human MVK Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC016140
Taille du ADNc:1191bp
Description du ADNc:Full length Clone DNA of Homo sapiens mevalonate kinase with C terminal Flag tag.
Synonyme du gène:MK, LRBP, MVLK, POROK3
Espèces:Human
Vecteur:pCMV3-C-FLAG
Plasmid:
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humain Mevalonate kinase / MVK expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur on other vectors
Humain Mevalonate kinase / MVK expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG13923-ACGCHF270
Humain Mevalonate kinase / MVK expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG13923-ACRCHF270
Humain Mevalonate kinase / MVK expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG13923-ANGCHF270
Humain Mevalonate kinase / MVK expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG13923-ANRCHF270
Humain Mevalonate kinase / MVK expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG13923-CFCHF230
Humain Mevalonate kinase / MVK expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG13923-CHCHF230
Humain Mevalonate kinase / MVK expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG13923-CMCHF230
Humain Mevalonate kinase / MVK expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG13923-CYCHF230
Humain Mevalonate kinase / MVK Gène ADNc clone le vecteur de clonageHG13923-GCHF90
Humain Mevalonate kinase / MVK expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG13923-NFCHF230
Humain Mevalonate kinase / MVK expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG13923-NHCHF230
Humain Mevalonate kinase / MVK expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG13923-NMCHF230
Humain Mevalonate kinase / MVK expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG13923-NYCHF230
Humain Mevalonate kinase / MVK expression plasmide de Gène l'ADNc ORF cloneHG13923-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

Mevalonate kinase belongs to the GHMP kinase family, Mevalonate kinase subfamily. It can be found in a wide variety of organisms from bacteria to mammals. Mevalonate kinase may be a regulatory site in cholesterol biosynthetic pathway. Defects in mevalonate kinase can cause mevalonic aciduria (MEVA). It is an accumulation of mevalonic acid which causes a variety of symptoms such as psychomotor retardation, dysmorphic features, cataracts, hepatosplenomegaly, lymphadenopathy, anemia, hypotonia, myopathy, and ataxia. Defects in mevalonate kinase can also cause hyperimmunoglobulinemia D and periodic fever syndrome (HIDS). HIDS is an autosomal recessive disease characterized by recurrent episodes of unexplained high fever associated with skin rash, diarrhea, adenopathy (swollen, tender lymph nodes), athralgias and/or arthritis.

Références
  • Fu Z, et al. (2008) Biochemical and structural basis for feedback inhibition of Mevalonate kinase and isoprenoid metabolism. Biochemistry. 47(12):3715-24.
  • Houten SM, et al. (2000) Biochemical and genetic aspects of Mevalonate kinase and its deficiency. Biochim Biophys Acta. 1529(1-3):19-32.
  • Schafer BL, et al. (1992) Molecular cloning of human Mevalonate kinase and identification of a missense mutation in the genetic disease mevalonic aciduria. J Biol Chem. 267(19): 13229-38.
  • Size / Price
    Catalogue : HG13923-CF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »