c-Myc / MYC cDNA ORF Clone, Human, C-DDK (Flag®) tag

1/2
Price:
Size:
Number:

c-Myc / MYC cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1404 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human v-myc myelocytomatosis viral oncogene homolog (avian) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+1.4kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

c-Myc / MYC cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

c-Myc / MYC cDNA ORF Clone, Human, C-DDK (Flag®) tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

c-Myc / MYC cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

bHLHe39 cDNA ORF Clone, Human; c-Myc cDNA ORF Clone, Human; MRTL cDNA ORF Clone, Human; MYCC cDNA ORF Clone, Human

c-Myc / MYC Background Information

Myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein. It can help to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. Myc Tag also can be used to isolate protein complexes with multiple subunits. The Myc Tag Antibody is produced by the conjugation of a synthetic Myc tag peptide to KLH. Myc Tag Antibody can be used in various immunoassays, such as ELISA, Western blotting, immunoprecipitation, immunofluorescence, and more.
Full Name
v-myc avian myelocytomatosis viral oncogene homolog
References
  • Ding X, et al., 2009, PLoS One. 4(6): e5949.
  • Ratsima H, et al., 2011, Proc Natl Acad Sci. 108(43): E914-23.
  • Chiang YJ, et al., 2013, PLoS One. 8(4): e61761.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait