NAA10 / ARD1 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Price:
Size:
Number:

NAA10 / ARD1 cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
708 bp
Description
Full length Clone DNA of Human N(alpha)-acetyltransferase 10, NatA catalytic subunit with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

NAA10 / ARD1 cDNA ORF Clone, Human, N-DDK (Flag®) tag: Alternative Names

ARD1 cDNA ORF Clone, Human; ARD1A cDNA ORF Clone, Human; ARD1P cDNA ORF Clone, Human; DXS707 cDNA ORF Clone, Human; MCOPS1 cDNA ORF Clone, Human; NAA10 cDNA ORF Clone, Human; NATD cDNA ORF Clone, Human; OGDNS cDNA ORF Clone, Human; TE2 cDNA ORF Clone, Human

NAA10 / ARD1 Background Information

ARD1 is a member of the 2-kDa ARF protein family. It is a multifunctional protein. ARD1 has an 18-kDa ADP-ribosylation factor (ARF) domain at the C-terminus (amino acids 43-574), and a 46-kDa N-terminal domain (amino acids 1-42). The C-terminal region of ARD1 may be involved in the formation of both ARD1-ARD1 and ARD1-NAT1 complexes. ARD1 and NAT1 genes are required for the expression of an N-terminal protein acetyltransferase. This activity is required for full repression of the silent mating type locus HML, for sporulation, and for entry into G. Recombinant ARD1 (amino acids 1-574) or its RING finger domain (amino acids 1-11) produced polyubiquitylated proteins when incubated in vitro with a mammalian E1, an E2 enzyme, ATP, and ubiquitin.
Full Name
N(alpha)-acetyltransferase 10, NatA catalytic subunit
References
  • Tribioli C., et al.,(1994), Isolation of new genes in distal Xq28: transcriptional map and identification of a human homologue of the ARD1 N-acetyl transferase of Saccharomyces cerevisiae. Hum. Mol. Genet. 3:1061-1068.
  • Arnesen T., et al., (2005), Identification and characterization of the human ARD1-NATH protein acetyltransferase complex.Biochem. J. 386:433-443.
  • Ross M.T., et al.,(2005), The DNA sequence of the human X chromosome.Nature 434:325-337.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait