Commande rapide

Humain NAT2/AAC2 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human NAT2 Informations sur les produits clonés de cDNA
Taille du ADNc:873bp
Description du ADNc:Full length Clone DNA of Homo sapiens N-acetyltransferase 2 (arylamine N-acetyltransferase) with N terminal Flag tag.
Synonyme du gène:AAC2, PNAT,
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humain NAT2/AAC2 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur on other vectors
Humain NAT2/AAC2 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG11247-ACGCHF270
Humain NAT2/AAC2 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG11247-ACRCHF270
Humain NAT2/AAC2 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG11247-ANGCHF270
Humain NAT2/AAC2 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG11247-ANRCHF270
Humain NAT2/AAC2 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11247-CFCHF230
Humain NAT2/AAC2 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG11247-CHCHF230
Humain NAT2/AAC2 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG11247-CMCHF230
Humain NAT2/AAC2 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG11247-CYCHF230
Humain NAT2/AAC2 Gène ADNc clone le vecteur de clonageHG11247-MCHF90
Humain NAT2/AAC2 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11247-M-FCHF230
Humain NAT2/AAC2 expression plasmide de Gène l'ADNc ORF cloneHG11247-M-NCHF230
Humain NAT2/AAC2 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG11247-NFCHF230
Humain NAT2/AAC2 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG11247-NHCHF230
Humain NAT2/AAC2 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG11247-NMCHF230
Humain NAT2/AAC2 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG11247-NYCHF230
Humain NAT2/AAC2 expression plasmide de Gène l'ADNc ORF cloneHG11247-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG11247-NF
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.