After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain NCAM1 / CD56 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Human NCAM1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001076682.2
Taille du ADNc:2286bp
Description du ADNc:Full length Clone DNA of Homo sapiens neural cell adhesion molecule 1.
Synonyme du gène:CD56, NCAM, MSK39, NCAM1
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Fond

NCAM1, also known as CD56, is a neural adhesion protein (NCAM) which belongs to the immunoglobulin superfamily. NCAM is involved in neural development and in plasticity in the adult brain. UCHL1 is a novel interaction partner of both NCAM isoforms that regulates their ubiquitination and intracellular trafficking. NCAM1 is a cell adhesion molecule involved in neuron-neuron adhesion, neurite fasciculation, outgrowth of neurites, etc. NCAM1 has also been shown to be involved in the expansion of T cells and dendritic cells which play an important role in immune surveillance.

Références
  • Reyes AA. et al., 1991, Mol Cell Biol. 11 (3): 1654-61.
  • Suzuki M. et al., 2003, J Biol Chem. 278 (49): 49459-68.
  • Becker C G. et al., 1996, J Neurosci Res. 45 (2): 143-52.
  • Size / Price
    Catalogue : HG10673-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »