After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human NCR3LG1 natural ORF mammalian expression plasmid

Fiche techniqueCommentairesProduits apparentésProtocoles
Human NCR3LG1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001202439.2
Taille du ADNc:1365bp
Description du ADNc:Full length Clone DNA of Homo sapiens natural killer cell cytotoxicity receptor 3 ligand 1.
Synonyme du gène:B7H6, B7-H6, DKFZp686O24166
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:pCMV3-NCR3LG1
Site de restriction:KpnI + XbaI (6.1kb + 1.37kb)
Séquence du marqueur:
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human NCR3LG1 Gene Plasmid Map
Human NCR3LG1 natural ORF mammalian expression plasmid
Product nameProduct name
Size / Price
Catalogue : HG16140-UT
Prix catalogue :   (Save )
Prix :      [How to order]
DisponibilitéIn StockInstructions d’expédition
Images
  • Human NCR3LG1 natural ORF mammalian expression plasmid
    Articles consultés récemment
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »