Commande rapide

Humain B7-H6/B7H6 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Humain NCR3LG1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001202439.2
Taille du ADNc:1365bp
Description du ADNc:Full length Clone DNA of Homo sapiens natural killer cell cytotoxicity receptor 3 ligand 1.
Synonyme du gène:B7H6, B7-H6, DKFZp686O24166
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:pCMV3-NCR3LG1
Site de restriction:KpnI + XbaI (6.1kb + 1.37kb)
Séquence du marqueur:
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Humain NCR3LG1 Gene Plasmid Map
Human NCR3LG1 natural ORF mammalian expression plasmid
Product nameProduct name
Size / Price
Catalogue : HG16140-UT
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité
Ajouter au panierBulk Discount Requiry
Contact Us
Images
  • Human NCR3LG1 natural ORF mammalian expression plasmid
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »