After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain NEK3 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Human NEK3 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_152720.1
Taille du ADNc:1521bp
Description du ADNc:Full length Clone DNA of Homo sapiens NIMA (never in mitosis gene a)-related kinase 3, transcript variant 2.
Synonyme du gène:HSPK36, MGC29949, NEK3
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:pCMV3-NEK3
Site de restriction:KpnI + XbaI (6.1kb + 1.52kb)
Séquence du marqueur:
Description de la séquence:Identical with the Gene Bank Ref. ID sequence except for the point mutation 1236T/G not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human NEK3 Gene Plasmid Map
Human NEK3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humain NEK3 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone on other vectors
Humain NEK3 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10675-ACGCHF290
Humain NEK3 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10675-ACRCHF290
Humain NEK3 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10675-ANGCHF290
Humain NEK3 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10675-ANRCHF290
Humain NEK3 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10675-CFCHF260
Humain NEK3 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10675-CHCHF260
Humain NEK3 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10675-CMCHF260
Humain NEK3 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10675-CYCHF260
Humain NEK3 transcript variant 2 Gène ADNc clone le vecteur de clonageHG10675-MCHF90
Humain NEK3 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10675-M-FCHF260
Humain NEK3 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10675-NFCHF260
Humain NEK3 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10675-NHCHF260
Humain NEK3 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10675-NMCHF260
Humain NEK3 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10675-NYCHF260
Humain NEK3 transcript variant 2 expression plasmide de Gène l'ADNc ORF cloneHG10675-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

NEK3 (NIMA (never in mitosis gene a)-related expressed kinase 3), contains 1 protein kinase domain and is a member of the NimA (never in mitosis A) family of serine/threonine protein kinases. Members of the NEK family of protein kinases share high amino acid homology with NIMA (never in mitosis gene a). NEK3 differs from other NimA family members in that it is not cell cycle regulated and is found primarily in the cytoplasm. It is activated by prolactin stimulation, leading to phosphorylation of VAV2 guanine nucleotide exchange factor, paxillin, and activation of the RAC1 GTPase. NEK3 mRNA can be detected in all the proliferating cell lines with the amount not changing during the cell cycle. Prolactin stimulates interaction between NEK3 and paxillin leading to increased paxillin phosphorylation, Analysis of breast tissue microarrays show a significant up-regulation of NEK3 expression in malignant versus normal specimens. Multiple transcript variants encoding different isoforms have been found for NEK3 gene. NEK3 may play a role in mitotic regulation.

Références
  • Miller SL, et al. (2007) Nek3 kinase regulates prolactin-mediated cytoskeletal reorganization and motility of breast cancer cells. Oncogene. 26(32):4668-78.
  • Hernandez M, et al. (2006) Is there any association between nek3 and cancers with frequent 13q14 deletion?. Cancer Invest. 24(7):682-8.
  • Tanaka K, et al. (1999) Cloning and characterization of the murine Nek3 protein kinase, a novel member of the NIMA family of putative cell cycle regulators. J Biol Chem. 274(19):13491-7.
  • Size / Price
    Catalogue : HG10675-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    DisponibilitéIn Stock
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
    • Human NEK3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »