Commande rapide

Humain Neuroligin 3 / NLGN3 expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human NLGN3 Informations sur les produits clonés de cDNA
Taille du ADNc:2487bp
Description du ADNc:Full length Clone DNA of Homo sapiens neuroligin 3 with C terminal HA tag.
Synonyme du gène:HNL3, ASPGX1, AUTSX1, KIAA1480, NLGN3
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

Neuroligin 3 (NLGN3) is a member of the type-B carboxylesterase/lipase family. Neuroligins (NLGNs) are a family of presumptive postsynaptic cell adhesion molecules. Neuroligins (NLs) constitute a family of cell-surface proteins that interact with neurexins (beta-Nxs), another class of neuronal cell-surface proteins, one of each class functioning together in synapse formation. Neuroligins control the formation and functional balance of excitatory and inhibitory synapses in hippocampal neurons. NLGN1 and NLGN2 isoforms are concentrated at glutamatergic and GABAergic synapses, respectively, but the cellular expression and synaptic localization of the endogenous. NLGN3 was enriched in brain, where NLGN3 protein levels increased during postnatal development, coinciding with the peak of synaptogenesis. The NLGN3 is a synaptic adhesion molecule that is a shared component of glutamatergic and GABAergic synapses. Mutations in NLGN3 gene may be associated with autism and Asperger syndrome.

  • Chih B, et al. (2005) Control of excitatory and inhibitory synapse formation by neuroligins. Science. 307(5713): 1324-8.
  • Paraoanu LE, et al. (2006) Expression patterns of neurexin-1 and neuroligins in brain and retina of the chick embryo: Neuroligin-3 is absent in retina. Neurosci Lett. 395(2): 114-7.
  • Budreck EC, et al. (2007) Neuroligin-3 is a neuronal adhesion protein at GABAergic and glutamatergic synapses. Eur J Neurosci. 26(7): 1738-48.
  • Size / Price
    Catalogue : HG11160-CY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.