Commande rapide

Humain NMNAT1 expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human NMNAT1 Informations sur les produits clonés de cDNA
Taille du ADNc:840bp
Description du ADNc:Full length Clone DNA of Homo sapiens nicotinamide nucleotide adenylyltransferase 1 with N terminal Myc tag.
Synonyme du gène:NMNAT, PNAT1, NMNAT1
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

NMNAT, also known as NMNAT1, is a member of the Nicotinamide-nucleotide adenylyltransferases. It is widely expressed with high levels in skeletal muscle, heart, liver and kidney. NMNAT appears to have the ability to protect against axonal degeneration following mechanical or toxic insults. The coenzyme NAD and its derivatives are involved in hundreds of metabolic redox reactions and are utilized in protein ADP-ribosylation, histone deacetylation, and in some Ca(2+) signaling pathways. NMNAT enzyme is vital for NAD biosynthesis, catalyzing the condensation of nicotinamide mononucleotide (NMN) or nicotinic acid mononucleotide (NaMN) with the AMP moiety of ATP to form NAD or NaAD.

  • Sugano S. et al., 1994, Gene. 138 (1-2): 171-4.
  • Saccucci F. et al., 2001, J Biol Chem. 276 (1): 406-12.
  • Hennig K. et al., 2001, FEBS Lett. 492 (1-2): 95-100.
  • Size / Price
    Catalogue : HG11448-NM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.