Commande rapide

Text Size:AAA

Humain NPM1/Nucleophosmin transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human NPM1 Informations sur les produits clonés de cDNA
Taille du ADNc:885bp
Description du ADNc:Full length Clone DNA of Homo sapiens nucleophosmin (nucleolar phosphoprotein B23, numatrin) with N terminal Flag tag.
Synonyme du gène:B23, NPM
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humain NPM1/Nucleophosmin transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur on other vectors
Humain NPM1/Nucleophosmin transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG12074-ACGCHF270
Humain NPM1/Nucleophosmin transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG12074-ACRCHF270
Humain NPM1/Nucleophosmin transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG12074-ANGCHF270
Humain NPM1/Nucleophosmin transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG12074-ANRCHF270
Humain NPM1/Nucleophosmin transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG12074-CFCHF230
Humain NPM1/Nucleophosmin transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG12074-CHCHF230
Humain NPM1/Nucleophosmin transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG12074-CMCHF230
Humain NPM1/Nucleophosmin transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG12074-CYCHF230
Humain NPM1/Nucleophosmin transcript variant 1 Gène ADNc clone le vecteur de clonageHG12074-GCHF90
Humain NPM1/Nucleophosmin transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG12074-NFCHF230
Humain NPM1/Nucleophosmin transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG12074-NHCHF230
Humain NPM1/Nucleophosmin transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG12074-NMCHF230
Humain NPM1/Nucleophosmin transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG12074-NYCHF230
Humain NPM1/Nucleophosmin transcript variant 1 expression plasmide de Gène l'ADNc ORF cloneHG12074-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Nucleophosmin 1 (NPM1), also known as nucleolar phosphoprotein B23 or numatrin, is a member of the nucleoplasmin family. Nucleophosmin (NPM) is a nucleolar phosphoprotein that plays multiple roles in ribosome assembly and transport, cytoplasmic-nuclear trafficking, centrosome duplication and regulation of p53. The NPM1 gene is frequently involved in chromosomal translocation, mutation and deletion. Mutations of the NPM1 gene leading to the expression of a cytoplasmic mutant protein, NPMc+, are the most frequent genetic abnormalities found in acute myeloid leukemias. Acute myeloid leukemias (AML) with mutated NPM1 have distinct characteristics, including a significant association with a normal karyotype, involvement of different hematopoietic lineages, a specific gene-expression profile and clinically, a better response to induction therapy and a favorable prognosis. In addition, NPM1 is a crucial gene to consider in the context of the genetics and biology of cancer. NPM1 is frequently overexpressed, mutated, rearranged and deleted in human cancer. Traditionally regarded as a tumour marker and a putative proto-oncogene, it has now also been attributed with tumour-suppressor functions.

  • Chen W, et al. (2006) Nucleophosmin gene mutations in acute myeloid leukemia. Arch Pathol Lab Med. 130(11): 1687-92.
  • Naoe T, et al. (2006) Nucleophosmin: a versatile molecule associated with hematological malignancies. Cancer Sci. 97(10): 963-9.
  • Grisendi S, et al. (2006) Nucleophosmin and cancer. Nat Rev Cancer. 6(7): 493-505.
  • Falini B, et al. (2007) Acute myeloid leukemia carrying cytoplasmic/mutated nucleophosmin (NPMc+ AML): biologic and clinical features. Blood. 109(3): 874-85.
  • Meani N, et al. (2009) Role of nucleophosmin in acute myeloid leukemia. Expert Rev Anticancer Ther. 9(9): 1283-94.
  • Size / Price
    Catalogue : HG12074-NF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.